EMAIL THIS PAGE TO A FRIEND

SLC9A5

solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5

57 Gene Product Result for
Synonyms: NHE5
UniProtKB ID: Q14940, A5PKY7, Q9Y626
Gene ID:
Mouse(277973) solute carrier family 9 (sodium/hydrogen exchanger), member 5
Rat(192215) solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
domestic guinea pig(100732120) solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
naked mole-rat(101716008) solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
cow(512686) solute carrier family 9 (sodium/hydrogen exchanger), member 5
sheep(101107725) solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
Zebrafish(565213) solute carrier family 9 (sodium/hydrogen exchanger), member 5
domestic cat(101088801) solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
dog(609901) solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
chicken(100857416) solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A9561 5-(N,N-Hexamethylene)amiloride human, mouse, rat pricing
A3085 5-(N-Ethyl-N-isopropyl)amiloride human, mouse, rat pricing
C4522 Cimetidine human, mouse, rat pricing
51330 Harmaline ≥95% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004594 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004594 Rosetta Predictions human pricing
NM_138858 Rosetta Predictions rat pricing
NM_001081332 Rosetta Predictions mouse pricing
XM_894890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197051 predicted 1354
2 SASI_Hs01_00197052 predicted 654
3 SASI_Hs01_00197053 predicted 1403
4 SASI_Hs02_00337958 predicted 242
5 SASI_Hs01_00197054 predicted 1718
6 SASI_Hs01_00197055 predicted 1348
7 SASI_Hs01_00197056 predicted 1377
8 SASI_Hs01_00197057 predicted 1629
9 SASI_Hs01_00197058 predicted 1029
10 SASI_Hs02_00337959 predicted 1653
11 SASI_Hs01_00197059 predicted 1746
12 SASI_Hs01_00197060 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068703 predicted 1356
2 SASI_Rn02_00268264 predicted 1051
3 SASI_Rn01_00068704 predicted 2056
4 SASI_Rn01_00068706 predicted 1621
5 SASI_Rn01_00068707 predicted 628
6 SASI_Rn01_00068708 predicted 669
7 SASI_Rn01_00068709 predicted 1985
8 SASI_Rn01_00068710 predicted 1377
9 SASI_Rn01_00068712 predicted 1335
10 SASI_Rn02_00268265 predicted 1696
11 SASI_Rn01_00068705 predicted 2160
12 SASI_Rn01_00068711 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297381 predicted 3064
2 SASI_Mm02_00297382 predicted 3062
3 SASI_Mm02_00297383 predicted 2099
4 SASI_Mm02_00297384 predicted 2710
5 SASI_Mm02_00297385 predicted 3078
6 SASI_Mm02_00297386 predicted 2784
7 SASI_Mm02_00297387 predicted 2464
8 SASI_Mm02_00297388 predicted 2422
9 SASI_Mm02_00297389 predicted 3272
10 SASI_Mm02_00297390 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244702 predicted 3071
2 SASI_Mm01_00244703 predicted 3068
3 SASI_Mm01_00244704 predicted 3123
4 SASI_Mm01_00244705 predicted 2107
5 SASI_Mm01_00244706 predicted 2714
6 SASI_Mm01_00244707 predicted 3083
7 SASI_Mm01_00244708 predicted 2787
8 SASI_Mm01_00244709 predicted 2474
9 SASI_Mm01_00244710 predicted 2424
10 SASI_Mm01_00244711 predicted 3281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081332
SLC9A5 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-2399s21c1
Sequence:CCGGTCCCTGCCAAGGACTACTTTGCTCGAGCAAAGTAGTCCTTGGCAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-1473s21c1
Sequence:CCGGCGTGCTAGACTCAGGCTATTTCTCGAGAAATAGCCTGAGTCTAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-3207s21c1
Sequence:CCGGCACAGCTGCAGTGATACTAACCTCGAGGTTAGTATCACTGCAGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-3054s21c1
Sequence:CCGGGCGACGGCTTGAGTCCTTTAACTCGAGTTAAAGGACTCAAGCCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081332.1-4408s21c1
Sequence:CCGGGTCTACTGCATTAGGTCTAAACTCGAGTTTAGACCTAATGCAGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081332
SLC9A5 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-2399s21c1
Sequence:CCGGTCCCTGCCAAGGACTACTTTGCTCGAGCAAAGTAGTCCTTGGCAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-1473s21c1
Sequence:CCGGCGTGCTAGACTCAGGCTATTTCTCGAGAAATAGCCTGAGTCTAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-3207s21c1
Sequence:CCGGCACAGCTGCAGTGATACTAACCTCGAGGTTAGTATCACTGCAGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-3054s21c1
Sequence:CCGGGCGACGGCTTGAGTCCTTTAACTCGAGTTAAAGGACTCAAGCCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081332.1-4408s21c1
Sequence:CCGGGTCTACTGCATTAGGTCTAAACTCGAGTTTAGACCTAATGCAGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081332
SLC9A5 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-2399s21c1
Sequence:CCGGTCCCTGCCAAGGACTACTTTGCTCGAGCAAAGTAGTCCTTGGCAGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-1473s21c1
Sequence:CCGGCGTGCTAGACTCAGGCTATTTCTCGAGAAATAGCCTGAGTCTAGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-3207s21c1
Sequence:CCGGCACAGCTGCAGTGATACTAACCTCGAGGTTAGTATCACTGCAGCTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081332.1-3054s21c1
Sequence:CCGGGCGACGGCTTGAGTCCTTTAACTCGAGTTAAAGGACTCAAGCCGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081332.1-4408s21c1
Sequence:CCGGGTCTACTGCATTAGGTCTAAACTCGAGTTTAGACCTAATGCAGTAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004594
SLC9A5 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004594.2-409s21c1
Sequence:CCGGGTGTTGGACTCAGGCTATTTCCTCGAGGAAATAGCCTGAGTCCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004594.2-2956s21c1
Sequence:CCGGTGCCACTTTCTGTTTCATTAACTCGAGTTAATGAAACAGAAAGTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-256s1c1
Sequence:CCGGGTGTTTCACCTGTCTCGGAAACTCGAGTTTCCGAGACAGGTGAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-660s1c1
Sequence:CCGGCGTCAATGAGACTCTCTTTATCTCGAGATAAAGAGAGTCTCATTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-2101s1c1
Sequence:CCGGGCTGAGGCTACAAATGGGAAACTCGAGTTTCCCATTTGTAGCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-1043s1c1
Sequence:CCGGGCACAACTGTCAAATATACAACTCGAGTTGTATATTTGACAGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-1365s1c1
Sequence:CCGGCACCACTATTGTAGTGGTCTTCTCGAGAAGACCACTACAATAGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004594
SLC9A5 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004594.2-409s21c1
Sequence:CCGGGTGTTGGACTCAGGCTATTTCCTCGAGGAAATAGCCTGAGTCCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004594.2-2956s21c1
Sequence:CCGGTGCCACTTTCTGTTTCATTAACTCGAGTTAATGAAACAGAAAGTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-256s1c1
Sequence:CCGGGTGTTTCACCTGTCTCGGAAACTCGAGTTTCCGAGACAGGTGAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-660s1c1
Sequence:CCGGCGTCAATGAGACTCTCTTTATCTCGAGATAAAGAGAGTCTCATTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-2101s1c1
Sequence:CCGGGCTGAGGCTACAAATGGGAAACTCGAGTTTCCCATTTGTAGCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-1043s1c1
Sequence:CCGGGCACAACTGTCAAATATACAACTCGAGTTGTATATTTGACAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-1365s1c1
Sequence:CCGGCACCACTATTGTAGTGGTCTTCTCGAGAAGACCACTACAATAGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004594
SLC9A5 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004594.2-409s21c1
Sequence:CCGGGTGTTGGACTCAGGCTATTTCCTCGAGGAAATAGCCTGAGTCCAACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004594.2-2956s21c1
Sequence:CCGGTGCCACTTTCTGTTTCATTAACTCGAGTTAATGAAACAGAAAGTGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-256s1c1
Sequence:CCGGGTGTTTCACCTGTCTCGGAAACTCGAGTTTCCGAGACAGGTGAAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-660s1c1
Sequence:CCGGCGTCAATGAGACTCTCTTTATCTCGAGATAAAGAGAGTCTCATTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-2101s1c1
Sequence:CCGGGCTGAGGCTACAAATGGGAAACTCGAGTTTCCCATTTGTAGCCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-1043s1c1
Sequence:CCGGGCACAACTGTCAAATATACAACTCGAGTTGTATATTTGACAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004594.1-1365s1c1
Sequence:CCGGCACCACTATTGTAGTGGTCTTCTCGAGAAGACCACTACAATAGTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)