EMAIL THIS PAGE TO A FRIEND

SLC9A9

solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9

117 Gene Product Result for
Synonyms: AUTS16 NHE9
UniProtKB ID: Q8IVB4, A6NMQ9, Q3LIC2, Q5JPI6, Q5WA58, Q8NAB9
Gene ID:
Human(285195) Summary: This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Mouse(331004) solute carrier family 9 (sodium/hydrogen exchanger), member 9
Rat(363115) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
domestic guinea pig(100714328) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
naked mole-rat(101707022) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
cow(535743) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
sheep(101104196) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
chicken(424772) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
dog(611417) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
Horse(100051114) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
domestic cat(101087002) solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173653 Rosetta Predictions human pricing
XM_001064905 Rosetta Predictions rat pricing
XM_343448 Rosetta Predictions rat pricing
NM_177909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062225 predicted 650
2 SASI_Hs01_00062226 predicted 909
3 SASI_Hs02_00368556 predicted 1462
4 SASI_Hs01_00062227 predicted 712
5 SASI_Hs01_00062228 predicted 387
6 SASI_Hs01_00062230 predicted 2049
7 SASI_Hs01_00062231 predicted 301
8 SASI_Hs01_00062232 predicted 460
9 SASI_Hs01_00062233 predicted 510
10 SASI_Hs02_00368557 predicted 867
11 SASI_Hs01_00062229 predicted 2048
12 SASI_Hs01_00062234 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312200 predicted 671
2 SASI_Rn02_00312201 predicted 890
3 SASI_Rn02_00312202 predicted 1502
4 SASI_Rn02_00312203 predicted 933
5 SASI_Rn02_00312204 predicted 733
6 SASI_Rn02_00312205 predicted 533
7 SASI_Rn02_00312206 predicted 887
8 SASI_Rn02_00312207 predicted 407
9 SASI_Rn02_00312208 predicted 2075
10 SASI_Rn02_00312209 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125231 predicted 1810
2 SASI_Rn01_00125232 predicted 1739
3 SASI_Rn01_00125233 predicted 1761
4 SASI_Rn01_00125234 predicted 1774
5 SASI_Rn01_00125235 predicted 1712
6 SASI_Rn01_00125236 predicted 1785
7 SASI_Rn01_00125237 predicted 1777
8 SASI_Rn01_00125238 predicted 1832
9 SASI_Rn01_00125239 predicted 1809
10 SASI_Rn01_00125240 predicted 1782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166631 predicted 473
2 SASI_Mm01_00166632 predicted 901
3 SASI_Mm01_00166633 predicted 682
4 SASI_Mm01_00166634 predicted 2095
5 SASI_Mm01_00166635 predicted 736
6 SASI_Mm01_00166636 predicted 2075
7 SASI_Mm01_00166638 predicted 2087
8 SASI_Mm01_00166639 predicted 939
9 SASI_Mm01_00166640 predicted 891
10 SASI_Mm02_00348392 predicted 416
11 SASI_Mm01_00166637 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173653
SLC9A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173653.2-451s21c1
Sequence:CCGGCATCAACTCTGCTGGTTAATACTCGAGTATTAACCAGCAGAGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-1695s1c1
Sequence:CCGGCGGCTCTTCAGAATGTGGTATCTCGAGATACCACATTCTGAAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173653.2-1399s21c1
Sequence:CCGGTTGCCAGAGCCTGCAACATATCTCGAGATATGTTGCAGGCTCTGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-646s1c1
Sequence:CCGGGCATCGTCATAGGGTTAATTACTCGAGTAATTAACCCTATGACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173653.1-2430s1c1
Sequence:CCGGCCCTCCATTAAGGAGAGTTTACTCGAGTAAACTCTCCTTAATGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-1887s1c1
Sequence:CCGGGCCATAAATTACCAGGAGCAACTCGAGTTGCTCCTGGTAATTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-288s1c1
Sequence:CCGGGCAATGGTGTATGGCCTTATACTCGAGTATAAGGCCATACACCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173653
SLC9A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173653.2-451s21c1
Sequence:CCGGCATCAACTCTGCTGGTTAATACTCGAGTATTAACCAGCAGAGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-1695s1c1
Sequence:CCGGCGGCTCTTCAGAATGTGGTATCTCGAGATACCACATTCTGAAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173653.2-1399s21c1
Sequence:CCGGTTGCCAGAGCCTGCAACATATCTCGAGATATGTTGCAGGCTCTGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-646s1c1
Sequence:CCGGGCATCGTCATAGGGTTAATTACTCGAGTAATTAACCCTATGACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173653.1-2430s1c1
Sequence:CCGGCCCTCCATTAAGGAGAGTTTACTCGAGTAAACTCTCCTTAATGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-1887s1c1
Sequence:CCGGGCCATAAATTACCAGGAGCAACTCGAGTTGCTCCTGGTAATTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-288s1c1
Sequence:CCGGGCAATGGTGTATGGCCTTATACTCGAGTATAAGGCCATACACCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173653
SLC9A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173653.2-451s21c1
Sequence:CCGGCATCAACTCTGCTGGTTAATACTCGAGTATTAACCAGCAGAGTTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-1695s1c1
Sequence:CCGGCGGCTCTTCAGAATGTGGTATCTCGAGATACCACATTCTGAAGAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173653.2-1399s21c1
Sequence:CCGGTTGCCAGAGCCTGCAACATATCTCGAGATATGTTGCAGGCTCTGGCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-646s1c1
Sequence:CCGGGCATCGTCATAGGGTTAATTACTCGAGTAATTAACCCTATGACGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173653.1-2430s1c1
Sequence:CCGGCCCTCCATTAAGGAGAGTTTACTCGAGTAAACTCTCCTTAATGGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-1887s1c1
Sequence:CCGGGCCATAAATTACCAGGAGCAACTCGAGTTGCTCCTGGTAATTTATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173653.1-288s1c1
Sequence:CCGGGCAATGGTGTATGGCCTTATACTCGAGTATAAGGCCATACACCATTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177909
SLC9A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-1415s1c1
Sequence:CCGGCTGGGCAGAAAGCAGAAGATTCTCGAGAATCTTCTGCTTTCTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-901s1c1
Sequence:CCGGCCTCACATACTCTATATCCATCTCGAGATGGATATAGAGTATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-330s1c1
Sequence:CCGGGCCTCATAATGGGACTAATTTCTCGAGAAATTAGTCCCATTATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-369s1c1
Sequence:CCGGCGACTGATATTGATAGTGGAACTCGAGTTCCACTATCAATATCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-2006s1c1
Sequence:CCGGGAGAATATCTACGAGGGAGATCTCGAGATCTCCCTCGTAGATATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177909
SLC9A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-1415s1c1
Sequence:CCGGCTGGGCAGAAAGCAGAAGATTCTCGAGAATCTTCTGCTTTCTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-901s1c1
Sequence:CCGGCCTCACATACTCTATATCCATCTCGAGATGGATATAGAGTATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-330s1c1
Sequence:CCGGGCCTCATAATGGGACTAATTTCTCGAGAAATTAGTCCCATTATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-369s1c1
Sequence:CCGGCGACTGATATTGATAGTGGAACTCGAGTTCCACTATCAATATCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-2006s1c1
Sequence:CCGGGAGAATATCTACGAGGGAGATCTCGAGATCTCCCTCGTAGATATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177909
SLC9A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-1415s1c1
Sequence:CCGGCTGGGCAGAAAGCAGAAGATTCTCGAGAATCTTCTGCTTTCTGCCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-901s1c1
Sequence:CCGGCCTCACATACTCTATATCCATCTCGAGATGGATATAGAGTATGTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-330s1c1
Sequence:CCGGGCCTCATAATGGGACTAATTTCTCGAGAAATTAGTCCCATTATGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-369s1c1
Sequence:CCGGCGACTGATATTGATAGTGGAACTCGAGTTCCACTATCAATATCAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177909.2-2006s1c1
Sequence:CCGGGAGAATATCTACGAGGGAGATCTCGAGATCTCCCTCGTAGATATTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)