EMAIL THIS PAGE TO A FRIEND

SLCO1A2

solute carrier organic anion transporter family, member 1A2

69 Gene Product Result for
Synonyms: OATP OATP-A OATP1A2 SLC21A3
UniProtKB ID: P46721, Q9UGP7, Q9UL38
Gene ID:
Human(6579) Summary: This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Rat(170698) solute carrier organic anion transporter family, member 1A2
domestic guinea pig(100714302) solute carrier organic anion transporter family, member 1A2
naked mole-rat(101702734) solute carrier organic anion transporter family, member 1A2
Domestic Rabbit(100355617) solute carrier organic anion transporter family, member 1A2
cow(282472) solute carrier organic anion transporter family, member 1A2
sheep(101119972) solute carrier organic anion transporter family, member 1A2
chicken(418190) solute carrier organic anion transporter family, member 1A2
Horse(100034162) solute carrier organic anion transporter family, member 1A2
domestic cat(101087585) solute carrier organic anion transporter family, member 1A2
dog(403520) solute carrier organic anion transporter family, member 1A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_134431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_134431 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065911 MISSION® esiRNA esiRNA human SLCO1A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005075 Rosetta Predictions human pricing
NM_021094 Rosetta Predictions human pricing
NM_134431 Rosetta Predictions human pricing
NM_131906 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147993 predicted 698
2 SASI_Hs01_00147994 predicted 545
3 SASI_Hs01_00147995 predicted 1338
4 SASI_Hs01_00147996 predicted 527
5 SASI_Hs01_00147997 predicted 556
6 SASI_Hs01_00147998 predicted 1465
7 SASI_Hs01_00147999 predicted 1469
8 SASI_Hs01_00148000 predicted 740
9 SASI_Hs01_00148001 predicted 1477
10 SASI_Hs02_00338912 predicted 1480
11 SASI_Hs01_00147992 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228523 predicted 733
2 SASI_Hs01_00228524 predicted 590
3 SASI_Hs01_00228525 predicted 1383
4 SASI_Hs01_00228526 predicted 567
5 SASI_Hs01_00228527 predicted 599
6 SASI_Hs01_00228528 predicted 1509
7 SASI_Hs01_00228529 predicted 1511
8 SASI_Hs01_00228530 predicted 775
9 SASI_Hs01_00228531 predicted 1518
10 SASI_Hs02_00354579 predicted 1527
11 SASI_Hs01_00228522 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363324 predicted 1729
2 SASI_Hs01_00093694 predicted 1037
3 SASI_Hs01_00093695 predicted 1070
4 SASI_Hs01_00093696 predicted 1974
5 SASI_Hs01_00093697 predicted 1544
6 SASI_Hs01_00093698 predicted 1778
7 SASI_Hs01_00093699 predicted 1749
8 SASI_Hs01_00093700 predicted 1993
9 SASI_Hs01_00093701 predicted 1695
10 SASI_Hs01_00093703 predicted 1199
11 SASI_Hs01_00093702 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109694 predicted 779
2 SASI_Rn01_00109695 predicted 2177
3 SASI_Rn02_00267533 predicted 2145
4 SASI_Rn01_00109696 predicted 2070
5 SASI_Rn01_00109697 predicted 291
6 SASI_Rn01_00109698 predicted 721
7 SASI_Rn02_00267534 predicted 1176
8 SASI_Rn01_00109699 predicted 1971
9 SASI_Rn01_00109700 predicted 1112
10 SASI_Rn01_00109701 predicted 1304
11 SASI_Rn01_00109702 predicted 1430
12 SASI_Rn01_00109703 predicted 280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005075
SLCO1A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier organic anion transporter family, member 1A2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-1270s1c1
Sequence:CCGGGCAATCTTTCTAATGGGTATTCTCGAGAATACCCATTAGAAAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-401s1c1
Sequence:CCGGGCTTTGAGATTGGAAATCTTTCTCGAGAAAGATTTCCAATCTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-1664s1c1
Sequence:CCGGGCTGTATTCAAACATCAGGAACTCGAGTTCCTGATGTTTGAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-801s1c1
Sequence:CCGGGCTTGTAGAAACAGGAGCTATCTCGAGATAGCTCCTGTTTCTACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-266s1c1
Sequence:CCGGCCAAGATGTTTCTGTTGGCAACTCGAGTTGCCAACAGAAACATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005075
SLCO1A2 MISSION shRNA shRNA Plasmid DNA
solute carrier organic anion transporter family, member 1A2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-1270s1c1
Sequence:CCGGGCAATCTTTCTAATGGGTATTCTCGAGAATACCCATTAGAAAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-401s1c1
Sequence:CCGGGCTTTGAGATTGGAAATCTTTCTCGAGAAAGATTTCCAATCTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-1664s1c1
Sequence:CCGGGCTGTATTCAAACATCAGGAACTCGAGTTCCTGATGTTTGAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-801s1c1
Sequence:CCGGGCTTGTAGAAACAGGAGCTATCTCGAGATAGCTCCTGTTTCTACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-266s1c1
Sequence:CCGGCCAAGATGTTTCTGTTGGCAACTCGAGTTGCCAACAGAAACATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005075
SLCO1A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier organic anion transporter family, member 1A2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-1270s1c1
Sequence:CCGGGCAATCTTTCTAATGGGTATTCTCGAGAATACCCATTAGAAAGATTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-401s1c1
Sequence:CCGGGCTTTGAGATTGGAAATCTTTCTCGAGAAAGATTTCCAATCTCAAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-1664s1c1
Sequence:CCGGGCTGTATTCAAACATCAGGAACTCGAGTTCCTGATGTTTGAATACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-801s1c1
Sequence:CCGGGCTTGTAGAAACAGGAGCTATCTCGAGATAGCTCCTGTTTCTACAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005075.2-266s1c1
Sequence:CCGGCCAAGATGTTTCTGTTGGCAACTCGAGTTGCCAACAGAAACATCTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134431
SLCO1A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier organic anion transporter family, member 1A2
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000426688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134431.3-2997s21c1
Sequence:CCGGCCCTTAATTCATCGAAGTAAGCTCGAGCTTACTTCGATGAATTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134431.3-1199s21c1
Sequence:CCGGTACGTCCTAGTAGGCAATATTCTCGAGAATATTGCCTACTAGGACGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134431
SLCO1A2 MISSION shRNA shRNA Plasmid DNA
solute carrier organic anion transporter family, member 1A2
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000426688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134431.3-2997s21c1
Sequence:CCGGCCCTTAATTCATCGAAGTAAGCTCGAGCTTACTTCGATGAATTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134431.3-1199s21c1
Sequence:CCGGTACGTCCTAGTAGGCAATATTCTCGAGAATATTGCCTACTAGGACGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134431
SLCO1A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier organic anion transporter family, member 1A2
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000426688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134431.3-2997s21c1
Sequence:CCGGCCCTTAATTCATCGAAGTAAGCTCGAGCTTACTTCGATGAATTAAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134431.3-1199s21c1
Sequence:CCGGTACGTCCTAGTAGGCAATATTCTCGAGAATATTGCCTACTAGGACGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???