EMAIL THIS PAGE TO A FRIEND

SLITRK1

SLIT and NTRK-like family, member 1

154 Gene Product Result for
Synonyms: LRRC12 TTM
UniProtKB ID: Q96PX8, Q5U5I6, Q96SF9
Gene ID:
Human(114798) Summary: This intronless gene encodes a member of the SLITRK protein family. These proteins are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. However, the protein encoded by this gene lacks the region of homology to neurotrophin receptors. The protein is thought to be involved in neurite outgrowth. Mutations in this gene may be associated with Tourette syndrome.[provided by RefSeq, Mar 2010]
Mouse(76965) SLIT and NTRK-like family, member 1
Rat(306147) SLIT and NTRK-like family, member 1
domestic guinea pig(100729298) SLIT and NTRK-like family, member 1
Domestic Rabbit(100347903) SLIT and NTRK-like family, member 1
cow(615880) SLIT and NTRK-like family, member 1
sheep(101105580) SLIT and NTRK-like family, member 1
chicken(418798) SLIT and NTRK-like family, member 1
dog(485509) SLIT and NTRK-like family, member 1
Horse(100050220) SLIT and NTRK-like family, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1703 Human SLITRK1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_127898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052910 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156001 MISSION® esiRNA esiRNA human SLITRK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052910 Rosetta Predictions human pricing
NM_001107283 Rosetta Predictions rat pricing
NM_199065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041932 predicted 1080
2 SASI_Hs01_00041933 predicted 1792
3 SASI_Hs01_00041934 predicted 2857
4 SASI_Hs01_00041935 predicted 2640
5 SASI_Hs01_00041936 predicted 1803
6 SASI_Hs02_00361666 predicted 1128
7 SASI_Hs01_00041937 predicted 1463
8 SASI_Hs01_00041938 predicted 2861
9 SASI_Hs01_00041940 predicted 1755
10 SASI_Hs01_00041941 predicted 1630
11 SASI_Hs01_00041939 predicted 2587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227315 predicted 919
2 SASI_Rn02_00227316 predicted 791
3 SASI_Rn02_00227317 predicted 1293
4 SASI_Rn02_00227318 predicted 1941
5 SASI_Rn02_00227319 predicted 1782
6 SASI_Rn02_00227320 predicted 2101
7 SASI_Rn02_00227321 predicted 2329
8 SASI_Rn02_00227322 predicted 2131
9 SASI_Rn02_00227323 predicted 1636
10 SASI_Rn02_00227324 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351339 predicted 1159
2 SASI_Mm02_00351340 predicted 2134
3 SASI_Mm02_00351341 predicted 1035
4 SASI_Mm02_00351342 predicted 2341
5 SASI_Mm01_00029771 predicted 1530
6 SASI_Mm02_00351343 predicted 2720
7 SASI_Mm01_00029774 predicted 2017
8 SASI_Mm01_00029775 predicted 2374
9 SASI_Mm02_00351344 predicted 1036
10 SASI_Mm01_00029776 predicted 1883
11 SASI_Mm01_00029770 predicted 1393
12 SASI_Mm01_00029772 predicted 512
13 SASI_Mm01_00029773 predicted 253
14 SASI_Mm01_00029777 predicted 1602
15 SASI_Mm01_00029778 predicted 1292
16 SASI_Mm01_00029779 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127898
SLITRK1 MISSION shRNA Bacterial Glycerol Stock
SLIT and NTRK-like family, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1098s1c1
Sequence:CCGGCTTGGCTGATTTGAAGCCTAACTCGAGTTAGGCTTCAAATCAGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1389s1c1
Sequence:CCGGCCCTGGTACTTTCAATGCCATCTCGAGATGGCATTGAAAGTACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1411s1c1
Sequence:CCGGCCGAAACTGAGGATTCTTATTCTCGAGAATAAGAATCCTCAGTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-508s1c1
Sequence:CCGGCCTGCTAATGTATTCCAGTATCTCGAGATACTGGAATACATTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1281s1c1
Sequence:CCGGGCTCTACATGGATAGTAACTACTCGAGTAGTTACTATCCATGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127898
SLITRK1 MISSION shRNA shRNA Plasmid DNA
SLIT and NTRK-like family, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1098s1c1
Sequence:CCGGCTTGGCTGATTTGAAGCCTAACTCGAGTTAGGCTTCAAATCAGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1389s1c1
Sequence:CCGGCCCTGGTACTTTCAATGCCATCTCGAGATGGCATTGAAAGTACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1411s1c1
Sequence:CCGGCCGAAACTGAGGATTCTTATTCTCGAGAATAAGAATCCTCAGTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-508s1c1
Sequence:CCGGCCTGCTAATGTATTCCAGTATCTCGAGATACTGGAATACATTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1281s1c1
Sequence:CCGGGCTCTACATGGATAGTAACTACTCGAGTAGTTACTATCCATGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127898
SLITRK1 MISSION shRNA Lentiviral Transduction Particles
SLIT and NTRK-like family, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1098s1c1
Sequence:CCGGCTTGGCTGATTTGAAGCCTAACTCGAGTTAGGCTTCAAATCAGCCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1389s1c1
Sequence:CCGGCCCTGGTACTTTCAATGCCATCTCGAGATGGCATTGAAAGTACCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1411s1c1
Sequence:CCGGCCGAAACTGAGGATTCTTATTCTCGAGAATAAGAATCCTCAGTTTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-508s1c1
Sequence:CCGGCCTGCTAATGTATTCCAGTATCTCGAGATACTGGAATACATTAGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127898.4-1281s1c1
Sequence:CCGGGCTCTACATGGATAGTAACTACTCGAGTAGTTACTATCCATGTAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052910
SLITRK1 MISSION shRNA Bacterial Glycerol Stock
SLIT and NTRK-like family, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2386s1c1
Sequence:CCGGCCTGCACAACAATTACTTCATCTCGAGATGAAGTAATTGTTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2072s1c1
Sequence:CCGGGTGGATTACAAGAACCTCATTCTCGAGAATGAGGTTCTTGTAATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-1136s1c1
Sequence:CCGGGCGGTTAGTTTGCACATGGAACTCGAGTTCCATGTGCAAACTAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2566s1c1
Sequence:CCGGGCCGGTGAACTTCTTTAGAAACTCGAGTTTCTAAAGAAGTTCACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052910.1-3649s1c1
Sequence:CCGGCGCCATTATTTGTGATCGGTACTCGAGTACCGATCACAAATAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052910.1-2635s21c1
Sequence:CCGGTAGGATCTCGCCCACGTTAACCTCGAGGTTAACGTGGGCGAGATCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052910.1-3311s21c1
Sequence:CCGGCCGCGGTTCTATACATATATACTCGAGTATATATGTATAGAACCGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052910.1-3088s21c1
Sequence:CCGGGATGGGCATAAGTAGATAAATCTCGAGATTTATCTACTTATGCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052910
SLITRK1 MISSION shRNA shRNA Plasmid DNA
SLIT and NTRK-like family, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2386s1c1
Sequence:CCGGCCTGCACAACAATTACTTCATCTCGAGATGAAGTAATTGTTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2072s1c1
Sequence:CCGGGTGGATTACAAGAACCTCATTCTCGAGAATGAGGTTCTTGTAATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-1136s1c1
Sequence:CCGGGCGGTTAGTTTGCACATGGAACTCGAGTTCCATGTGCAAACTAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2566s1c1
Sequence:CCGGGCCGGTGAACTTCTTTAGAAACTCGAGTTTCTAAAGAAGTTCACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052910.1-3649s1c1
Sequence:CCGGCGCCATTATTTGTGATCGGTACTCGAGTACCGATCACAAATAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052910.1-2635s21c1
Sequence:CCGGTAGGATCTCGCCCACGTTAACCTCGAGGTTAACGTGGGCGAGATCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052910.1-3311s21c1
Sequence:CCGGCCGCGGTTCTATACATATATACTCGAGTATATATGTATAGAACCGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052910.1-3088s21c1
Sequence:CCGGGATGGGCATAAGTAGATAAATCTCGAGATTTATCTACTTATGCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052910
SLITRK1 MISSION shRNA Lentiviral Transduction Particles
SLIT and NTRK-like family, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2386s1c1
Sequence:CCGGCCTGCACAACAATTACTTCATCTCGAGATGAAGTAATTGTTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2072s1c1
Sequence:CCGGGTGGATTACAAGAACCTCATTCTCGAGAATGAGGTTCTTGTAATCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-1136s1c1
Sequence:CCGGGCGGTTAGTTTGCACATGGAACTCGAGTTCCATGTGCAAACTAACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052910.1-2566s1c1
Sequence:CCGGGCCGGTGAACTTCTTTAGAAACTCGAGTTTCTAAAGAAGTTCACCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052910.1-3649s1c1
Sequence:CCGGCGCCATTATTTGTGATCGGTACTCGAGTACCGATCACAAATAATGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052910.1-2635s21c1
Sequence:CCGGTAGGATCTCGCCCACGTTAACCTCGAGGTTAACGTGGGCGAGATCCTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052910.1-3311s21c1
Sequence:CCGGCCGCGGTTCTATACATATATACTCGAGTATATATGTATAGAACCGCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052910.1-3088s21c1
Sequence:CCGGGATGGGCATAAGTAGATAAATCTCGAGATTTATCTACTTATGCCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199065
SLITRK1 MISSION shRNA Bacterial Glycerol Stock
SLIT and NTRK-like family, member 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000363032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2724s21c1
Sequence:CCGGACGTTAACTTCGCACAGTAAACTCGAGTTTACTGTGCGAAGTTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2926s21c1
Sequence:CCGGATTCCTCTGCGTCCGAAATTACTCGAGTAATTTCGGACGCAGAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199065.2-3164s21c1
Sequence:CCGGCCGATGGACATGAGTAAATAACTCGAGTTATTTACTCATGTCCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2372s21c1
Sequence:CCGGGCCGAAACTGAGGATTCTTATCTCGAGATAAGAATCCTCAGTTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199065
SLITRK1 MISSION shRNA shRNA Plasmid DNA
SLIT and NTRK-like family, member 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000363032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2724s21c1
Sequence:CCGGACGTTAACTTCGCACAGTAAACTCGAGTTTACTGTGCGAAGTTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2926s21c1
Sequence:CCGGATTCCTCTGCGTCCGAAATTACTCGAGTAATTTCGGACGCAGAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199065.2-3164s21c1
Sequence:CCGGCCGATGGACATGAGTAAATAACTCGAGTTATTTACTCATGTCCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2372s21c1
Sequence:CCGGGCCGAAACTGAGGATTCTTATCTCGAGATAAGAATCCTCAGTTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199065
SLITRK1 MISSION shRNA Lentiviral Transduction Particles
SLIT and NTRK-like family, member 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000363032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2724s21c1
Sequence:CCGGACGTTAACTTCGCACAGTAAACTCGAGTTTACTGTGCGAAGTTAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2926s21c1
Sequence:CCGGATTCCTCTGCGTCCGAAATTACTCGAGTAATTTCGGACGCAGAGGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199065.2-3164s21c1
Sequence:CCGGCCGATGGACATGAGTAAATAACTCGAGTTATTTACTCATGTCCATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199065.2-2372s21c1
Sequence:CCGGGCCGAAACTGAGGATTCTTATCTCGAGATAAGAATCCTCAGTTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)