EMAIL THIS PAGE TO A FRIEND

SLITRK3

SLIT and NTRK-like family, member 3

139 Gene Product Result for
UniProtKB ID: O94933, Q1RMY6
Gene ID:
Human(22865) Summary: Members of the SLITRK family, such as SLITRK3, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK3, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]
Mouse(386750) SLIT and NTRK-like family, member 3
Rat(310519) SLIT and NTRK-like family, member 3
domestic guinea pig(100729632) SLIT and NTRK-like family, member 3
naked mole-rat(101712288) SLIT and NTRK-like family, member 3
Domestic Rabbit(100338251) SLIT and NTRK-like family, member 3
cow(527364) SLIT and NTRK-like family, member 3
sheep(101102360) SLIT and NTRK-like family, member 3
chicken(771488) SLIT and NTRK-like family, member 3
Horse(100063273) SLIT and NTRK-like family, member 3
domestic cat(101091137) SLIT and NTRK-like family, member 3
dog(608925) SLIT and NTRK-like family, member 3
chicken(101667000) SLIT and NTRK-like family, member 3
chicken(101747514) SLIT and NTRK-like family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014926 Rosetta Predictions human pricing
NM_001107683 Rosetta Predictions rat pricing
NM_198864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050904 predicted 804
2 SASI_Hs01_00050905 predicted 1918
3 SASI_Hs01_00050906 predicted 1774
4 SASI_Hs01_00050907 predicted 675
5 SASI_Hs01_00050908 predicted 2798
6 SASI_Hs01_00050909 predicted 1842
7 SASI_Hs01_00050911 predicted 284
8 SASI_Hs01_00050912 predicted 1076
9 SASI_Hs02_00346583 predicted 313
10 SASI_Hs02_00346584 predicted 619
11 SASI_Hs01_00050910 predicted 1017
12 SASI_Hs01_00050913 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231245 predicted 2592
2 SASI_Rn02_00231246 predicted 1371
3 SASI_Rn02_00231247 predicted 806
4 SASI_Rn02_00231248 predicted 366
5 SASI_Rn02_00231249 predicted 3028
6 SASI_Rn02_00231250 predicted 662
7 SASI_Rn02_00231251 predicted 853
8 SASI_Rn02_00231252 predicted 2420
9 SASI_Rn02_00231253 predicted 1988
10 SASI_Rn02_00231254 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351194 predicted 744
2 SASI_Mm01_00054178 predicted 2083
3 SASI_Mm02_00351195 predicted 2890
4 SASI_Mm01_00054179 predicted 1594
5 SASI_Mm01_00054180 predicted 935
6 SASI_Mm01_00054181 predicted 599
7 SASI_Mm01_00054183 predicted 2150
8 SASI_Mm01_00054184 predicted 2073
9 SASI_Mm01_00054185 predicted 623
10 SASI_Mm01_00054186 predicted 1391
11 SASI_Mm01_00054182 predicted 458
12 SASI_Mm01_00054187 predicted 1867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014926
SLITRK3 MISSION shRNA Bacterial Glycerol Stock
SLIT and NTRK-like family, member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-751s1c1
Sequence:CCGGCGAGGAATGCTAGATCACATTCTCGAGAATGTGATCTAGCATTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-3024s1c1
Sequence:CCGGGAAGACAACATACAGGTTCTACTCGAGTAGAACCTGTATGTTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014926.2-3244s21c1
Sequence:CCGGGGGCCATACTCAGATCATTAACTCGAGTTAATGATCTGAGTATGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014926.2-1906s21c1
Sequence:CCGGCACCGTGATGTGCGCACTATTCTCGAGAATAGTGCGCACATCACGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014926.2-1467s21c1
Sequence:CCGGTATCAACTTGCCCAACTTAAACTCGAGTTTAAGTTGGGCAAGTTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-2523s1c1
Sequence:CCGGCCATAGTAACTACCGGACCTTCTCGAGAAGGTCCGGTAGTTACTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-1081s1c1
Sequence:CCGGGTCGAATACAAGTCCTCAAATCTCGAGATTTGAGGACTTGTATTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014926.2-3511s1c1
Sequence:CCGGGCACAGATTCTGTACATGTATCTCGAGATACATGTACAGAATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-667s1c1
Sequence:CCGGCCCATGCTTCCAACCAATTTACTCGAGTAAATTGGTTGGAAGCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-1989s1c1
Sequence:CCGGGCCTGGAGATTCTCACCTTATCTCGAGATAAGGTGAGAATCTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014926
SLITRK3 MISSION shRNA shRNA Plasmid DNA
SLIT and NTRK-like family, member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-751s1c1
Sequence:CCGGCGAGGAATGCTAGATCACATTCTCGAGAATGTGATCTAGCATTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-3024s1c1
Sequence:CCGGGAAGACAACATACAGGTTCTACTCGAGTAGAACCTGTATGTTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014926.2-3244s21c1
Sequence:CCGGGGGCCATACTCAGATCATTAACTCGAGTTAATGATCTGAGTATGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014926.2-1906s21c1
Sequence:CCGGCACCGTGATGTGCGCACTATTCTCGAGAATAGTGCGCACATCACGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014926.2-1467s21c1
Sequence:CCGGTATCAACTTGCCCAACTTAAACTCGAGTTTAAGTTGGGCAAGTTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-2523s1c1
Sequence:CCGGCCATAGTAACTACCGGACCTTCTCGAGAAGGTCCGGTAGTTACTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-1081s1c1
Sequence:CCGGGTCGAATACAAGTCCTCAAATCTCGAGATTTGAGGACTTGTATTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014926.2-3511s1c1
Sequence:CCGGGCACAGATTCTGTACATGTATCTCGAGATACATGTACAGAATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-667s1c1
Sequence:CCGGCCCATGCTTCCAACCAATTTACTCGAGTAAATTGGTTGGAAGCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-1989s1c1
Sequence:CCGGGCCTGGAGATTCTCACCTTATCTCGAGATAAGGTGAGAATCTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014926
SLITRK3 MISSION shRNA Lentiviral Transduction Particles
SLIT and NTRK-like family, member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-751s1c1
Sequence:CCGGCGAGGAATGCTAGATCACATTCTCGAGAATGTGATCTAGCATTCCTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000150890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-3024s1c1
Sequence:CCGGGAAGACAACATACAGGTTCTACTCGAGTAGAACCTGTATGTTGTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000425047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014926.2-3244s21c1
Sequence:CCGGGGGCCATACTCAGATCATTAACTCGAGTTAATGATCTGAGTATGGCCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000439420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014926.2-1906s21c1
Sequence:CCGGCACCGTGATGTGCGCACTATTCTCGAGAATAGTGCGCACATCACGGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014926.2-1467s21c1
Sequence:CCGGTATCAACTTGCCCAACTTAAACTCGAGTTTAAGTTGGGCAAGTTGATATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-2523s1c1
Sequence:CCGGCCATAGTAACTACCGGACCTTCTCGAGAAGGTCCGGTAGTTACTATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000150889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-1081s1c1
Sequence:CCGGGTCGAATACAAGTCCTCAAATCTCGAGATTTGAGGACTTGTATTCGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000151567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014926.2-3511s1c1
Sequence:CCGGGCACAGATTCTGTACATGTATCTCGAGATACATGTACAGAATCTGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000152722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-667s1c1
Sequence:CCGGCCCATGCTTCCAACCAATTTACTCGAGTAAATTGGTTGGAAGCATGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000157606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014926.2-1989s1c1
Sequence:CCGGGCCTGGAGATTCTCACCTTATCTCGAGATAAGGTGAGAATCTCCAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198864
SLITRK3 MISSION shRNA Bacterial Glycerol Stock
SLIT and NTRK-like family, member 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000114075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-685s1c1
Sequence:CCGGCGATGAGAAGACTATACACAACTCGAGTTGTGTATAGTCTTCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-3150s1c1
Sequence:CCGGCCCAAATTAAAGGAACTCCATCTCGAGATGGAGTTCCTTTAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198864.2-3443s1c1
Sequence:CCGGCCCATTATACTTGTCCCAATACTCGAGTATTGGGACAAGTATAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-1788s1c1
Sequence:CCGGCCCAACCTGAAGAGTCTCTTTCTCGAGAAAGAGACTCTTCAGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198864
SLITRK3 MISSION shRNA shRNA Plasmid DNA
SLIT and NTRK-like family, member 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000114075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-685s1c1
Sequence:CCGGCGATGAGAAGACTATACACAACTCGAGTTGTGTATAGTCTTCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-3150s1c1
Sequence:CCGGCCCAAATTAAAGGAACTCCATCTCGAGATGGAGTTCCTTTAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198864.2-3443s1c1
Sequence:CCGGCCCATTATACTTGTCCCAATACTCGAGTATTGGGACAAGTATAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-1788s1c1
Sequence:CCGGCCCAACCTGAAGAGTCTCTTTCTCGAGAAAGAGACTCTTCAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198864
SLITRK3 MISSION shRNA Lentiviral Transduction Particles
SLIT and NTRK-like family, member 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000114075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-685s1c1
Sequence:CCGGCGATGAGAAGACTATACACAACTCGAGTTGTGTATAGTCTTCTCATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-3150s1c1
Sequence:CCGGCCCAAATTAAAGGAACTCCATCTCGAGATGGAGTTCCTTTAATTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198864.2-3443s1c1
Sequence:CCGGCCCATTATACTTGTCCCAATACTCGAGTATTGGGACAAGTATAATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198864.2-1788s1c1
Sequence:CCGGCCCAACCTGAAGAGTCTCTTTCTCGAGAAAGAGACTCTTCAGGTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???