EMAIL THIS PAGE TO A FRIEND

SMAD1

SMAD family member 1

139 Gene Product Result for
Synonyms: BSP-1 BSP1 JV4-1 JV41 MADH1 MADR1
UniProtKB ID: Q15797, A8KAJ0, D3DNZ9, Q16636
Gene ID:
Human(4086) Summary: The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Mouse(17125) SMAD family member 1
Rat(25671) SMAD family member 1
cow(540488) SMAD family member 1
sheep(443229) SMAD family member 1
domestic guinea pig(100727257) SMAD family member 1
naked mole-rat(101725903) SMAD family member 1
Domestic Rabbit(100341544) SMAD family member 1
Zebrafish(30628) MAD homolog 1 (Drosophila)
domestic cat(101085713) SMAD family member 1
Horse(100033850) SMAD family member 1
dog(475456) SMAD family member 1
chicken(395680) SMAD family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB3848-I Anti-phospho Smad1/Smad5/Smad8 (Ser463/465) Anti-phospho Smad1/Smad5/Smad8 (Ser463/465) Antibody, Cat. No. AB3848-I, is a highly specific rabbit polyclonal antibody that targets Smad1//5/8 phosphorylation and has been tested in Immunohistochemistry and Western Blotting. human, human, mouse, rat, mouse, rat
immunohistochemistry, western blot pricing
SAB4503779 Anti-phospho-Smad1 (pSer465) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300250 Anti-phospho-SMAD1 (pSer465) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
ABE2871 Anti-phospho-Smad1 (Ser463 Antibody, Ser465) Anti-phospho-Smad1 (Ser463, Ser465), Cat. No. ABE2871, is a highly specific rabbit polyclonal antibody that targets Mothers against decapentaplegic homolog 1 (Smad1) and has been tested in Immunoprecipitation and Western Blotting. human, human
immunoprecipitation (IP), western blot pricing
06-702 Anti-phospho-Smad1 (Ser463/465) Antibody Detect phospho-Smad1 (Ser463/465) with Anti-phospho-Smad1 (Ser463/465) Antibody (Rabbit Polyclonal Antibody), that has been shown to work in WB. Xenopus, rat, mouse, human
western blot pricing
SAB4300561 Anti-SMAD1 (Ab-465) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, western blot pricing
AV38692 Anti-SMAD1 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, rabbit, horse, guinea pig, mouse, dog, human, rat
immunohistochemistry, western blot pricing
SAB4200377 Anti-SMAD1 (Internal region) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1412594 ANTI-SMAD1 antibody produced in mouse clone 3G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412181 ANTI-SMAD1 antibody produced in mouse clone 1C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412595 ANTI-SMAD1 antibody produced in mouse clone 4C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412656 ANTI-SMAD1 antibody produced in mouse clone 1B8, purified immunoglobulin, buffered aqueous solution human,
ELISA, western blot pricing
SAB4200378 Anti-SMAD1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse
immunoprecipitation (IP), western blot pricing
AV32003 Anti-SMAD1 antibody produced in rabbit affinity isolated antibody rat, human, horse, rabbit, sheep, bovine, mouse, guinea pig
western blot pricing
SAB4501801 Anti-SMAD1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501802 Anti-SMAD1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, western blot pricing
SAB4501803 Anti-SMAD1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB2702532 Anti-SMAD1+5+8(9) antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
SAB1404035 Monoclonal Anti-SMAD1 antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0004086M2 Monoclonal Anti-SMAD1 antibody produced in mouse clone 1D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051601 MISSION® esiRNA esiRNA human SMAD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003688 Rosetta Predictions human pricing
NM_005900 Rosetta Predictions human pricing
NM_013130 Rosetta Predictions rat pricing
NM_008539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015677 predicted 614
2 SASI_Hs01_00015678 predicted 278
3 SASI_Hs01_00015680 predicted 1319
4 SASI_Hs01_00015681 predicted 421
5 SASI_Hs02_00304319 predicted 798
6 SASI_Hs01_00015683 predicted 290
7 SASI_Hs01_00015684 predicted 1136
8 SASI_Hs01_00015685 predicted 415
9 SASI_Hs01_00015686 predicted 1459
10 SASI_Hs02_00304320 predicted 988
11 SASI_Hs01_00015679 predicted 697
12 SASI_Hs01_00015682 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245782 predicted 787
2 SASI_Hs01_00245783 predicted 453
3 SASI_Hs01_00245785 predicted 1495
4 SASI_Hs01_00245786 predicted 596
5 SASI_Hs02_00340505 predicted 977
6 SASI_Hs01_00245788 predicted 470
7 SASI_Hs01_00245789 predicted 1304
8 SASI_Hs01_00245790 predicted 591
9 SASI_Hs01_00245791 predicted 1641
10 SASI_Hs02_00340506 predicted 1171
11 SASI_Hs01_00245784 predicted 874
12 SASI_Hs01_00245787 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083351 predicted 1150
2 SASI_Rn01_00083352 predicted 1713
3 SASI_Rn02_00260922 predicted 661
4 SASI_Rn01_00083353 predicted 386
5 SASI_Rn01_00083354 predicted 1415
6 SASI_Rn02_00260923 predicted 687
7 SASI_Rn01_00083357 predicted 1544
8 SASI_Rn01_00083358 predicted 1111
9 SASI_Rn01_00083359 predicted 1065
10 SASI_Rn01_00083360 predicted 1570
11 SASI_Rn01_00083355 predicted 1252
12 SASI_Rn01_00083356 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099028 predicted 1772
2 SASI_Mm01_00099029 predicted 1303
3 SASI_Mm01_00099030 predicted 1205
4 SASI_Mm01_00099031 predicted 449
5 SASI_Mm02_00314136 predicted 726
6 SASI_Mm01_00099034 predicted 1384
7 SASI_Mm02_00314137 predicted 1292
8 SASI_Mm01_00099035 predicted 1342
9 SASI_Mm01_00099036 predicted 1626
10 SASI_Mm01_00099037 predicted 1595
11 SASI_Mm01_00099032 predicted 1074
12 SASI_Mm01_00099033 predicted 1385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005900
SMAD1 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005900.2-1314s21c1
Sequence:CCGGACTGATCCTTCCAACAATAAGCTCGAGCTTATTGTTGGAAGGATCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005900.2-2133s21c1
Sequence:CCGGACGGTCCTAAGAGATTCTTTGCTCGAGCAAAGAATCTCTTAGGACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1473s1c1
Sequence:CCGGCCTTAGTGACAGTAGCATCTTCTCGAGAAGATGCTACTGTCACTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005900.2-834s21c1
Sequence:CCGGGTTCCAAGACACAGCGAATATCTCGAGATATTCGCTGTGTCTTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1217s1c1
Sequence:CCGGCGGTTGCTTATGAGGAACCAACTCGAGTTGGTTCCTCATAAGCAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-466s1c1
Sequence:CCGGCCAGCTGTGAAGAGACTTCTTCTCGAGAAGAAGTCTCTTCACAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1152s1c1
Sequence:CCGGGCCGATGGACACAAACATGATCTCGAGATCATGTTTGTGTCCATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1799s1c1
Sequence:CCGGCACCTCATAATCCTATTTCATCTCGAGATGAAATAGGATTATGAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005900
SMAD1 MISSION shRNA shRNA Plasmid DNA
SMAD family member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005900.2-1314s21c1
Sequence:CCGGACTGATCCTTCCAACAATAAGCTCGAGCTTATTGTTGGAAGGATCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005900.2-2133s21c1
Sequence:CCGGACGGTCCTAAGAGATTCTTTGCTCGAGCAAAGAATCTCTTAGGACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1473s1c1
Sequence:CCGGCCTTAGTGACAGTAGCATCTTCTCGAGAAGATGCTACTGTCACTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005900.2-834s21c1
Sequence:CCGGGTTCCAAGACACAGCGAATATCTCGAGATATTCGCTGTGTCTTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1217s1c1
Sequence:CCGGCGGTTGCTTATGAGGAACCAACTCGAGTTGGTTCCTCATAAGCAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-466s1c1
Sequence:CCGGCCAGCTGTGAAGAGACTTCTTCTCGAGAAGAAGTCTCTTCACAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1152s1c1
Sequence:CCGGGCCGATGGACACAAACATGATCTCGAGATCATGTTTGTGTCCATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1799s1c1
Sequence:CCGGCACCTCATAATCCTATTTCATCTCGAGATGAAATAGGATTATGAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005900
SMAD1 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005900.2-1314s21c1
Sequence:CCGGACTGATCCTTCCAACAATAAGCTCGAGCTTATTGTTGGAAGGATCAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005900.2-2133s21c1
Sequence:CCGGACGGTCCTAAGAGATTCTTTGCTCGAGCAAAGAATCTCTTAGGACCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1473s1c1
Sequence:CCGGCCTTAGTGACAGTAGCATCTTCTCGAGAAGATGCTACTGTCACTAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005900.2-834s21c1
Sequence:CCGGGTTCCAAGACACAGCGAATATCTCGAGATATTCGCTGTGTCTTGGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1217s1c1
Sequence:CCGGCGGTTGCTTATGAGGAACCAACTCGAGTTGGTTCCTCATAAGCAACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-466s1c1
Sequence:CCGGCCAGCTGTGAAGAGACTTCTTCTCGAGAAGAAGTCTCTTCACAGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1152s1c1
Sequence:CCGGGCCGATGGACACAAACATGATCTCGAGATCATGTTTGTGTCCATCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005900.1-1799s1c1
Sequence:CCGGCACCTCATAATCCTATTTCATCTCGAGATGAAATAGGATTATGAGGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008539
VALIDATED
SMAD1 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008539.3-1879s21c1
Sequence:CCGGGACGAAGGAGCCACGATAATACTCGAGTATTATCGTGGCTCCTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008539.3-641s21c1
Sequence:CCGGGGACTACCTCATGTCATTTATCTCGAGATAAATGACATGAGGTAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008539.3-1601s21c1
Sequence:CCGGACCGTGTATGAACTCACCAAACTCGAGTTTGGTGAGTTCATACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008539.3-1774s21c1
Sequence:CCGGTCCTATTTCATCCGTGTCTTACTCGAGTAAGACACGGATGAAATAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008539.3-1208s21c1
Sequence:CCGGTGGTGCTCTATTGTGTACTATCTCGAGATAGTACACAATAGAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-1208s1c1
Sequence:CCGGTGGTGCTCTATTGTGTACTATCTCGAGATAGTACACAATAGAGCACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-1774s1c1
Sequence:CCGGTCCTATTTCATCCGTGTCTTACTCGAGTAAGACACGGATGAAATAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008539.3-1601s1c1
Sequence:CCGGACCGTGTATGAACTCACCAAACTCGAGTTTGGTGAGTTCATACACGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-730s1c1
Sequence:CCGGCCCATTTGGTTCCAAGCAGAACTCGAGTTCTGCTTGGAACCAAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-577s1c1
Sequence:CCGGGCCGAGTAACTGCGTCACCATCTCGAGATGGTGACGCAGTTACTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008539
VALIDATED
SMAD1 MISSION shRNA shRNA Plasmid DNA
SMAD family member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008539.3-1879s21c1
Sequence:CCGGGACGAAGGAGCCACGATAATACTCGAGTATTATCGTGGCTCCTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008539.3-641s21c1
Sequence:CCGGGGACTACCTCATGTCATTTATCTCGAGATAAATGACATGAGGTAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008539.3-1601s21c1
Sequence:CCGGACCGTGTATGAACTCACCAAACTCGAGTTTGGTGAGTTCATACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008539.3-1774s21c1
Sequence:CCGGTCCTATTTCATCCGTGTCTTACTCGAGTAAGACACGGATGAAATAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008539.3-1208s21c1
Sequence:CCGGTGGTGCTCTATTGTGTACTATCTCGAGATAGTACACAATAGAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-1208s1c1
Sequence:CCGGTGGTGCTCTATTGTGTACTATCTCGAGATAGTACACAATAGAGCACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-1774s1c1
Sequence:CCGGTCCTATTTCATCCGTGTCTTACTCGAGTAAGACACGGATGAAATAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008539.3-1601s1c1
Sequence:CCGGACCGTGTATGAACTCACCAAACTCGAGTTTGGTGAGTTCATACACGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-730s1c1
Sequence:CCGGCCCATTTGGTTCCAAGCAGAACTCGAGTTCTGCTTGGAACCAAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-577s1c1
Sequence:CCGGGCCGAGTAACTGCGTCACCATCTCGAGATGGTGACGCAGTTACTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008539
VALIDATED
SMAD1 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008539.3-1879s21c1
Sequence:CCGGGACGAAGGAGCCACGATAATACTCGAGTATTATCGTGGCTCCTTCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008539.3-641s21c1
Sequence:CCGGGGACTACCTCATGTCATTTATCTCGAGATAAATGACATGAGGTAGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008539.3-1601s21c1
Sequence:CCGGACCGTGTATGAACTCACCAAACTCGAGTTTGGTGAGTTCATACACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008539.3-1774s21c1
Sequence:CCGGTCCTATTTCATCCGTGTCTTACTCGAGTAAGACACGGATGAAATAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008539.3-1208s21c1
Sequence:CCGGTGGTGCTCTATTGTGTACTATCTCGAGATAGTACACAATAGAGCACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-1208s1c1
Sequence:CCGGTGGTGCTCTATTGTGTACTATCTCGAGATAGTACACAATAGAGCACCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-1774s1c1
Sequence:CCGGTCCTATTTCATCCGTGTCTTACTCGAGTAAGACACGGATGAAATAGGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008539.3-1601s1c1
Sequence:CCGGACCGTGTATGAACTCACCAAACTCGAGTTTGGTGAGTTCATACACGGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-730s1c1
Sequence:CCGGCCCATTTGGTTCCAAGCAGAACTCGAGTTCTGCTTGGAACCAAATGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008539.3-577s1c1
Sequence:CCGGGCCGAGTAACTGCGTCACCATCTCGAGATGGTGACGCAGTTACTCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)