EMAIL THIS PAGE TO A FRIEND

SMAD2

SMAD family member 2

242 Gene Product Result for
Synonyms: JV18 JV18-1 MADH2 MADR2 hMAD-2 hSMAD2
UniProtKB ID: Q15796
Gene ID:
Human(4087) Summary: The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(17126) SMAD family member 2
Rat(29357) SMAD family member 2
Zebrafish(30639) MAD homolog 2 (Drosophila)
chicken(395247) SMAD family member 2
Horse(100033843) SMAD family member 2
domestic cat(101087179) SMAD family member 2
dog(480144) SMAD family member 2
Domestic Rabbit(100359137) SMAD family member 2
naked mole-rat(101714203) SMAD family member 2
domestic guinea pig(100726958) SMAD family member 2
cow(516010) SMAD family member 2
sheep(443170) SMAD family member 2
sheep(101114231) SMAD family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB3849-I Anti-phospho SMAD2 Antibody (Ser465/467) clone, from rabbit, purified by affinity chromatography human, human
western blot pricing
SAB4504207 Anti-phospho-Smad2 (pSer250) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301424 Anti-phospho-Smad2 (pSer250) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4301395 Anti-phospho-Smad2 (pSer465) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4300251 Anti-phospho-SMAD2 (pSer467) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4300252 Anti-phospho-SMAD2 (pThr220) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
ABE2872 Anti-phospho-Smad2 (Ser465 Antibody, Ser467) clone, from rabbit human, human, human
immunofluorescence, immunoprecipitation (IP), western blot pricing
04-953 Anti-phospho-Smad2 (Ser465/467) Antibody, clone A5S, rabbit monoclonal culture supernatant, clone A5S, Upstate® mouse, human, zebrafish, canine
western blot pricing
ZRB04953 Anti-phospho-Smad2 (Ser465/467) Antibody, clone A5S, ZooMAb® Rabbit Monoclonal recombinant, expressed in HEK 293 cells Antibody Enhanced Validation Green Alternative human
immunocytochemistry, immunohistochemistry, inhibition assay, western blot pricing
SAB5700402 Anti-Phospho-Smad2-S465/467 + Smad3-S423/425 antibody produced in rabbit New human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB5700544 Anti-Phospho-SMAD2-S465/S467 antibody produced in rabbit New mouse, human
western blot pricing
SAB4504208 Anti-phospho-Smad2/3 (pThr8) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4300563 Anti-SMAD2 (Ab-220) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300562 Anti-SMAD2 (Ab-467) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, western blot pricing
SAB4200354 Anti-SMAD2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4501804 Anti-SMAD2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501805 Anti-SMAD2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4501806 Anti-SMAD2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4501807 Anti-SMAD2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4501808 Anti-SMAD2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702053 Anti-SMAD2 antibody produced in rabbit human
ChIP, immunocytochemistry, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB5700256 Anti-SMAD2 antibody produced in rabbit New mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103328 Anti-SMAD2, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, horse, human, rat, bovine, guinea pig, mouse, dog
immunohistochemistry, western blot pricing
07-408 Anti-Smad2/3 Antibody clone, Upstate®, from rabbit mouse, rat, human
western blot pricing
SAB2500955 Anti-SMAD2/MADH2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1413191 Monoclonal Anti-SMAD2 (phospho S250) antibody produced in rabbit clone HBC-19 New human
flow cytometry, western blot pricing
SAB1413192 Monoclonal Anti-SMAD2 (phospho S255) antibody produced in rabbit clone HBE-19 New human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
AMAB91520 Monoclonal Anti-SMAD2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL8472, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB4100238 Monoclonal Anti-SMAD2 antibody produced in mouse clone SMAD2-B203, culture supernatant human
western blot pricing
SAB1404036 Monoclonal Anti-SMAD2 antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB1400158 Monoclonal Anti-SMAD2 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400159 Monoclonal Anti-SMAD2 antibody produced in mouse clone 3G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003652 Rosetta Predictions human pricing
NM_005901 Rosetta Predictions human pricing
NM_019191 Rosetta Predictions rat pricing
NM_010754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304295 predicted 1290
2 SASI_Hs02_00304296 predicted 1788
3 SASI_Hs01_00072280 predicted 1171
4 SASI_Hs01_00072281 predicted 1014
5 SASI_Hs01_00072282 predicted 1604
6 SASI_Hs01_00072283 predicted 1821
7 SASI_Hs02_00304297 predicted 1366
8 SASI_Hs01_00072286 predicted 760
9 SASI_Hs01_00072288 predicted 1835
10 SASI_Hs02_00304298 predicted 560
11 SASI_Hs01_00072284 predicted 490
12 SASI_Hs01_00072285 predicted 1331
13 SASI_Hs01_00072287 predicted 526
14 SASI_Hs01_00072289 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340507 predicted 1142
2 SASI_Hs02_00340508 predicted 1641
3 SASI_Hs01_00156150 predicted 1023
4 SASI_Hs01_00156151 predicted 873
5 SASI_Hs01_00156152 predicted 1450
6 SASI_Hs01_00156153 predicted 1674
7 SASI_Hs02_00340509 predicted 1217
8 SASI_Hs01_00156156 predicted 612
9 SASI_Hs01_00156158 predicted 1690
10 SASI_Hs02_00340510 predicted 410
11 SASI_Hs01_00156154 predicted 638
12 SASI_Hs01_00156155 predicted 1473
13 SASI_Hs01_00156157 predicted 675
14 SASI_Hs01_00156159 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076528 predicted 1357
2 SASI_Rn01_00076529 predicted 762
3 SASI_Rn01_00076531 predicted 1108
4 SASI_Rn01_00076532 predicted 1048
5 SASI_Rn01_00076533 predicted 1035
6 SASI_Rn01_00076534 predicted 575
7 SASI_Rn01_00076536 predicted 900
8 SASI_Rn02_00262004 predicted 784
9 SASI_Rn01_00076537 predicted 336
10 SASI_Rn02_00262005 predicted 747
11 SASI_Rn01_00076530 predicted 1192
12 SASI_Rn01_00076535 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022386 predicted 272
2 SASI_Mm01_00022387 predicted 1063
3 SASI_Mm01_00022388 predicted 730
4 SASI_Mm01_00022389 predicted 884
5 SASI_Mm02_00319273 predicted 430
6 SASI_Mm02_00319274 predicted 1451
7 SASI_Mm01_00022390 predicted 1502
8 SASI_Mm01_00022391 predicted 304
9 SASI_Mm01_00022392 predicted 1317
10 SASI_Mm01_00022393 predicted 1416
11 SASI_Mm01_00022394 predicted 878
12 SASI_Mm01_00022395 predicted 716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005901
VALIDATED
SMAD2 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-1631s1c1
Sequence:CCGGGCGTTGCTCAAGCATGTCATACTCGAGTATGACATGCTTGAGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-417s1c1
Sequence:CCGGCGATTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-1295s1c1
Sequence:CCGGCCTAAGTGATAGTGCAATCTTCTCGAGAAGATTGCACTATCACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1543s21c1
Sequence:CCGGCAAGTACTCCTTGCTGGATTGCTCGAGCAATCCAGCAAGGAGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-415s1c1
Sequence:CCGGACGATTAGATGAGCTTGAGACTCGAGTCTCAAGCTCATCTAATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-1543s1c1
Sequence:CCGGCAAGTACTCCTTGCTGGATTGCTCGAGCAATCCAGCAAGGAGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-1971s1c1
Sequence:CCGGCATGATCCAGTATCACAGTATCTCGAGATACTGTGATACTGGATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-417s21c1
Sequence:CCGGCGATTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1631s21c1
Sequence:CCGGGCGTTGCTCAAGCATGTCATACTCGAGTATGACATGCTTGAGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1295s21c1
Sequence:CCGGCCTAAGTGATAGTGCAATCTTCTCGAGAAGATTGCACTATCACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005901.4-1971s21c1
Sequence:CCGGCATGATCCAGTATCACAGTATCTCGAGATACTGTGATACTGGATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005901
VALIDATED
SMAD2 MISSION shRNA shRNA Plasmid DNA
SMAD family member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-1631s1c1
Sequence:CCGGGCGTTGCTCAAGCATGTCATACTCGAGTATGACATGCTTGAGCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-417s1c1
Sequence:CCGGCGATTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-1295s1c1
Sequence:CCGGCCTAAGTGATAGTGCAATCTTCTCGAGAAGATTGCACTATCACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1543s21c1
Sequence:CCGGCAAGTACTCCTTGCTGGATTGCTCGAGCAATCCAGCAAGGAGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-415s1c1
Sequence:CCGGACGATTAGATGAGCTTGAGACTCGAGTCTCAAGCTCATCTAATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-1543s1c1
Sequence:CCGGCAAGTACTCCTTGCTGGATTGCTCGAGCAATCCAGCAAGGAGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-1971s1c1
Sequence:CCGGCATGATCCAGTATCACAGTATCTCGAGATACTGTGATACTGGATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-417s21c1
Sequence:CCGGCGATTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1631s21c1
Sequence:CCGGGCGTTGCTCAAGCATGTCATACTCGAGTATGACATGCTTGAGCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1295s21c1
Sequence:CCGGCCTAAGTGATAGTGCAATCTTCTCGAGAAGATTGCACTATCACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005901.4-1971s21c1
Sequence:CCGGCATGATCCAGTATCACAGTATCTCGAGATACTGTGATACTGGATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005901
VALIDATED
SMAD2 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-1631s1c1
Sequence:CCGGGCGTTGCTCAAGCATGTCATACTCGAGTATGACATGCTTGAGCAACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-417s1c1
Sequence:CCGGCGATTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.3-1295s1c1
Sequence:CCGGCCTAAGTGATAGTGCAATCTTCTCGAGAAGATTGCACTATCACTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1543s21c1
Sequence:CCGGCAAGTACTCCTTGCTGGATTGCTCGAGCAATCCAGCAAGGAGTACTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-415s1c1
Sequence:CCGGACGATTAGATGAGCTTGAGACTCGAGTCTCAAGCTCATCTAATCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-1543s1c1
Sequence:CCGGCAAGTACTCCTTGCTGGATTGCTCGAGCAATCCAGCAAGGAGTACTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005901.x-1971s1c1
Sequence:CCGGCATGATCCAGTATCACAGTATCTCGAGATACTGTGATACTGGATCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-417s21c1
Sequence:CCGGCGATTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1631s21c1
Sequence:CCGGGCGTTGCTCAAGCATGTCATACTCGAGTATGACATGCTTGAGCAACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005901.4-1295s21c1
Sequence:CCGGCCTAAGTGATAGTGCAATCTTCTCGAGAAGATTGCACTATCACTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005901.4-1971s21c1
Sequence:CCGGCATGATCCAGTATCACAGTATCTCGAGATACTGTGATACTGGATCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010754
VALIDATED
SMAD2 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010754.2-1514s1c1
Sequence:CCGGCCCATCAAAGACTCGCTGTAACTCGAGTTACAGCGAGTCTTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-277s1c1
Sequence:CCGGCGGTTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-1076s1c1
Sequence:CCGGCCACTGTAGAAATGACAAGAACTCGAGTTCTTGTCATTTCTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010754.2-928s1c1
Sequence:CCGGTGGTGTTCAATCGCATACTATCTCGAGATAGTATGCGATTGAACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-1156s1c1
Sequence:CCGGCTAAGTGATAGTGCAATCTTTCTCGAGAAAGATTGCACTATCACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-276s21c1
Sequence:CCGGCGGTTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-927s21c1
Sequence:CCGGTGGTGTTCAATCGCATACTATCTCGAGATAGTATGCGATTGAACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-1075s21c1
Sequence:CCGGCCACTGTAGAAATGACAAGAACTCGAGTTCTTGTCATTTCTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-1155s21c1
Sequence:CCGGCTAAGTGATAGTGCAATCTTTCTCGAGAAAGATTGCACTATCACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010754.4-1513s21c1
Sequence:CCGGCCCATCAAAGACTCGCTGTAACTCGAGTTACAGCGAGTCTTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010754
VALIDATED
SMAD2 MISSION shRNA shRNA Plasmid DNA
SMAD family member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010754.2-1514s1c1
Sequence:CCGGCCCATCAAAGACTCGCTGTAACTCGAGTTACAGCGAGTCTTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-277s1c1
Sequence:CCGGCGGTTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-1076s1c1
Sequence:CCGGCCACTGTAGAAATGACAAGAACTCGAGTTCTTGTCATTTCTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010754.2-928s1c1
Sequence:CCGGTGGTGTTCAATCGCATACTATCTCGAGATAGTATGCGATTGAACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-1156s1c1
Sequence:CCGGCTAAGTGATAGTGCAATCTTTCTCGAGAAAGATTGCACTATCACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-276s21c1
Sequence:CCGGCGGTTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-927s21c1
Sequence:CCGGTGGTGTTCAATCGCATACTATCTCGAGATAGTATGCGATTGAACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-1075s21c1
Sequence:CCGGCCACTGTAGAAATGACAAGAACTCGAGTTCTTGTCATTTCTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-1155s21c1
Sequence:CCGGCTAAGTGATAGTGCAATCTTTCTCGAGAAAGATTGCACTATCACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010754.4-1513s21c1
Sequence:CCGGCCCATCAAAGACTCGCTGTAACTCGAGTTACAGCGAGTCTTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010754
VALIDATED
SMAD2 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010754.2-1514s1c1
Sequence:CCGGCCCATCAAAGACTCGCTGTAACTCGAGTTACAGCGAGTCTTTGATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-277s1c1
Sequence:CCGGCGGTTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-1076s1c1
Sequence:CCGGCCACTGTAGAAATGACAAGAACTCGAGTTCTTGTCATTTCTACAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010754.2-928s1c1
Sequence:CCGGTGGTGTTCAATCGCATACTATCTCGAGATAGTATGCGATTGAACACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010754.2-1156s1c1
Sequence:CCGGCTAAGTGATAGTGCAATCTTTCTCGAGAAAGATTGCACTATCACTTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-276s21c1
Sequence:CCGGCGGTTAGATGAGCTTGAGAAACTCGAGTTTCTCAAGCTCATCTAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-927s21c1
Sequence:CCGGTGGTGTTCAATCGCATACTATCTCGAGATAGTATGCGATTGAACACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-1075s21c1
Sequence:CCGGCCACTGTAGAAATGACAAGAACTCGAGTTCTTGTCATTTCTACAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010754.4-1155s21c1
Sequence:CCGGCTAAGTGATAGTGCAATCTTTCTCGAGAAAGATTGCACTATCACTTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010754.4-1513s21c1
Sequence:CCGGCCCATCAAAGACTCGCTGTAACTCGAGTTACAGCGAGTCTTTGATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???