EMAIL THIS PAGE TO A FRIEND

SMAD4

SMAD family member 4

156 Gene Product Result for
Synonyms: DPC4 JIP MADH4 MYHRS
UniProtKB ID: Q13485, A8K405
Gene ID:
Human(4089) Summary: This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
Mouse(17128) SMAD family member 4
Rat(50554) SMAD family member 4
Zebrafish(30640) MAD homolog 4 (Drosophila)
Horse(100033846) SMAD family member 4
domestic cat(101093650) SMAD family member 4
dog(476196) SMAD family member 4
naked mole-rat(101703764) SMAD family member 4
domestic guinea pig(100717853) SMAD family member 4
cow(540248) SMAD family member 4
sheep(443171) SMAD family member 4
Goat(100861019) SMAD family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412182 ANTI-SMAD4 antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB1412049 ANTI-SMAD4 antibody produced in mouse clone 4C6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412048 ANTI-SMAD4 antibody produced in mouse clone 4C5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412494 ANTI-SMAD4 antibody produced in mouse clone 4A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412495 ANTI-SMAD4 antibody produced in mouse clone 2G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412496 ANTI-SMAD4 antibody produced in mouse clone 3H1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412497 ANTI-SMAD4 antibody produced in mouse clone 2C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412498 ANTI-SMAD4 antibody produced in mouse clone 4D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412512 ANTI-SMAD4 antibody produced in mouse clone 1A5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412596 ANTI-SMAD4 antibody produced in mouse clone 1G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412597 ANTI-SMAD4 antibody produced in mouse clone 2E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA019154 Anti-SMAD4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102232 Anti-SMAD4 antibody produced in rabbit affinity isolated antibody sheep, dog, horse, rat, guinea pig, human, mouse, bovine, rabbit, goat
immunohistochemistry, western blot pricing
SAB4501814 Anti-SMAD4 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB2106277 Anti-SMAD4 antibody produced in rabbit affinity isolated antibody bovine, mouse, dog, horse, sheep, goat, guinea pig, rat, human
western blot pricing
SAB4200405 Anti-SMAD4 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
western blot pricing
ABE21 Anti-Smad4/DPC4 Antibody mouse, human, rat, mouse, chimpanzee, rat, human
immunocytochemistry, western blot pricing
S3934 Monoclonal Anti-Smad4 (DPC4) antibody produced in mouse clone DCS-46, ascites fluid human
immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB1404038 Monoclonal Anti-SMAD4 antibody produced in mouse clone 3E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing
AMAB91594 Monoclonal Anti-SMAD4 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL9774, purified immunoglobulin, buffered aqueous glycerol solution New human
immunohistochemistry, western blot pricing
SAB5300375 Monoclonal Anti-SMAD4 antibody produced in mouse clone 4G1C6, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1705 Human Smad4 ELISA for serum, plasma and cell culture supernatants human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0328 AQUA Peptide APGDAVH[K] African clawed frog, cow, dog, honey bee, human, mouse, pig, rat pricing
AQ0327 AQUA Peptide GFPHVIYA[R] Drosophila melanogaster, African clawed frog, cow, dog, honey bee, human, mouse, pig, rat, sheep pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005359 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005359 Rosetta Predictions human pricing
NM_019275 Rosetta Predictions rat pricing
NM_008540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207793 predicted 708
2 SASI_Hs01_00207794 predicted 1484
3 SASI_Hs01_00207795 predicted 630
4 SASI_Hs01_00207796 predicted 266
5 SASI_Hs01_00207797 predicted 457
6 SASI_Hs01_00207798 predicted 489
7 SASI_Hs01_00207800 predicted 591
8 SASI_Hs01_00207801 predicted 1748
9 SASI_Hs01_00207802 predicted 1794
10 SASI_Hs02_00339452 predicted 637
11 SASI_Hs01_00207799 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075005 predicted 582
2 SASI_Rn01_00075006 predicted 494
3 SASI_Rn02_00262192 predicted 500
4 SASI_Rn02_00262193 predicted 1013
5 SASI_Rn01_00075007 predicted 273
6 SASI_Rn02_00262194 predicted 498
7 SASI_Rn02_00262195 predicted 381
8 SASI_Rn01_00075009 predicted 576
9 SASI_Rn01_00075010 predicted 951
10 SASI_Rn01_00075011 predicted 358
11 SASI_Rn01_00075008 predicted 247
12 SASI_Rn01_00075012 predicted 1426
13 SASI_Rn01_00075013 predicted 1407
14 SASI_Rn01_00075014 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129736 predicted 586
2 SASI_Mm01_00129737 predicted 967
3 SASI_Mm01_00129738 predicted 959
4 SASI_Mm01_00129739 predicted 1324
5 SASI_Mm02_00314138 predicted 900
6 SASI_Mm01_00129740 predicted 763
7 SASI_Mm01_00129741 predicted 736
8 SASI_Mm01_00129742 predicted 883
9 SASI_Mm01_00129743 predicted 493
10 SASI_Mm01_00129744 predicted 810
11 SASI_Mm01_00129745 predicted 1735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008540
VALIDATED
SMAD4 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008540.2-1925s1c1
Sequence:CCGGGCGATTGTGCATTCTCAGGATCTCGAGATCCTGAGAATGCACAATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008540.2-1416s1c1
Sequence:CCGGGCTTACTTTGAAATGGACGTTCTCGAGAACGTCCATTTCAAAGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008540.2-1205s1c1
Sequence:CCGGGCCAGCTACTTACCATCATAACTCGAGTTATGATGGTAAGTAGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1722s21c1
Sequence:CCGGATCTACCCAAGCGCGTATATACTCGAGTATATACGCGCTTGGGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008540.2-981s21c1
Sequence:CCGGATCCAACACCCGCCAAGTAATCTCGAGATTACTTGGCGGGTGTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008540.2-1436s21c1
Sequence:CCGGTCAGGTAGGAGAGACGTTTAACTCGAGTTAAACGTCTCTCCTACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1256s21c1
Sequence:CCGGTGCACCATACACACCTAATTTCTCGAGAAATTAGGTGTGTATGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-916s21c1
Sequence:CCGGATGAGTACGTTCACGACTTTGCTCGAGCAAAGTCGTGAACGTACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1925s21c1
Sequence:CCGGGCGATTGTGCATTCTCAGGATCTCGAGATCCTGAGAATGCACAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008540
VALIDATED
SMAD4 MISSION shRNA shRNA Plasmid DNA
SMAD family member 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008540.2-1925s1c1
Sequence:CCGGGCGATTGTGCATTCTCAGGATCTCGAGATCCTGAGAATGCACAATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008540.2-1416s1c1
Sequence:CCGGGCTTACTTTGAAATGGACGTTCTCGAGAACGTCCATTTCAAAGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008540.2-1205s1c1
Sequence:CCGGGCCAGCTACTTACCATCATAACTCGAGTTATGATGGTAAGTAGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1722s21c1
Sequence:CCGGATCTACCCAAGCGCGTATATACTCGAGTATATACGCGCTTGGGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008540.2-981s21c1
Sequence:CCGGATCCAACACCCGCCAAGTAATCTCGAGATTACTTGGCGGGTGTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008540.2-1436s21c1
Sequence:CCGGTCAGGTAGGAGAGACGTTTAACTCGAGTTAAACGTCTCTCCTACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1256s21c1
Sequence:CCGGTGCACCATACACACCTAATTTCTCGAGAAATTAGGTGTGTATGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-916s21c1
Sequence:CCGGATGAGTACGTTCACGACTTTGCTCGAGCAAAGTCGTGAACGTACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1925s21c1
Sequence:CCGGGCGATTGTGCATTCTCAGGATCTCGAGATCCTGAGAATGCACAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008540
VALIDATED
SMAD4 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008540.2-1925s1c1
Sequence:CCGGGCGATTGTGCATTCTCAGGATCTCGAGATCCTGAGAATGCACAATCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008540.2-1416s1c1
Sequence:CCGGGCTTACTTTGAAATGGACGTTCTCGAGAACGTCCATTTCAAAGTAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008540.2-1205s1c1
Sequence:CCGGGCCAGCTACTTACCATCATAACTCGAGTTATGATGGTAAGTAGCTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1722s21c1
Sequence:CCGGATCTACCCAAGCGCGTATATACTCGAGTATATACGCGCTTGGGTAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008540.2-981s21c1
Sequence:CCGGATCCAACACCCGCCAAGTAATCTCGAGATTACTTGGCGGGTGTTGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008540.2-1436s21c1
Sequence:CCGGTCAGGTAGGAGAGACGTTTAACTCGAGTTAAACGTCTCTCCTACCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1256s21c1
Sequence:CCGGTGCACCATACACACCTAATTTCTCGAGAAATTAGGTGTGTATGGTGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-916s21c1
Sequence:CCGGATGAGTACGTTCACGACTTTGCTCGAGCAAAGTCGTGAACGTACTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008540.2-1925s21c1
Sequence:CCGGGCGATTGTGCATTCTCAGGATCTCGAGATCCTGAGAATGCACAATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005359
VALIDATED
SMAD4 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-1692s1c1
Sequence:CCGGGCTGCTGGAATTGGTGTTGATCTCGAGATCAACACCAATTCCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-636s1c1
Sequence:CCGGCGAGTTGTATCACCTGGAATTCTCGAGAATTCCAGGTGATACAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-1848s1c1
Sequence:CCGGGTACTTCATACCATGCCGATTCTCGAGAATCGGCATGGTATGAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005359.3-2038s1c1
Sequence:CCGGGCAGACAGAAACTGGATTAAACTCGAGTTTAATCCAGTTTCTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005359.5-2153s21c1
Sequence:CCGGGTACTTCATACCATGCCGATTCTCGAGAATCGGCATGGTATGAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.x-458s1c1
Sequence:CCGGTACCATACAGAGAACATTGGACTCGAGTCCAATGTTCTCTGTATGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.x-1735s1c1
Sequence:CCGGTATGCATACTCAGGATGAGTTCTCGAGAACTCATCCTGAGTATGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005359.x-2493s1c1
Sequence:CCGGCAGATTGTCTTGCAACTTCAGCTCGAGCTGAAGTTGCAAGACAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-2343s21c1
Sequence:CCGGGCAGACAGAAACTGGATTAAACTCGAGTTTAATCCAGTTTCTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-754s21c1
Sequence:CCGGTACCATACAGAGAACATTGGACTCGAGTCCAATGTTCTCTGTATGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005359.5-941s21c1
Sequence:CCGGCGAGTTGTATCACCTGGAATTCTCGAGAATTCCAGGTGATACAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-2789s21c1
Sequence:CCGGCAGATTGTCTTGCAACTTCAGCTCGAGCTGAAGTTGCAAGACAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005359
VALIDATED
SMAD4 MISSION shRNA shRNA Plasmid DNA
SMAD family member 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-1692s1c1
Sequence:CCGGGCTGCTGGAATTGGTGTTGATCTCGAGATCAACACCAATTCCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-636s1c1
Sequence:CCGGCGAGTTGTATCACCTGGAATTCTCGAGAATTCCAGGTGATACAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-1848s1c1
Sequence:CCGGGTACTTCATACCATGCCGATTCTCGAGAATCGGCATGGTATGAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005359.3-2038s1c1
Sequence:CCGGGCAGACAGAAACTGGATTAAACTCGAGTTTAATCCAGTTTCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005359.5-2153s21c1
Sequence:CCGGGTACTTCATACCATGCCGATTCTCGAGAATCGGCATGGTATGAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.x-458s1c1
Sequence:CCGGTACCATACAGAGAACATTGGACTCGAGTCCAATGTTCTCTGTATGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.x-1735s1c1
Sequence:CCGGTATGCATACTCAGGATGAGTTCTCGAGAACTCATCCTGAGTATGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005359.x-2493s1c1
Sequence:CCGGCAGATTGTCTTGCAACTTCAGCTCGAGCTGAAGTTGCAAGACAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-2343s21c1
Sequence:CCGGGCAGACAGAAACTGGATTAAACTCGAGTTTAATCCAGTTTCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-754s21c1
Sequence:CCGGTACCATACAGAGAACATTGGACTCGAGTCCAATGTTCTCTGTATGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005359.5-941s21c1
Sequence:CCGGCGAGTTGTATCACCTGGAATTCTCGAGAATTCCAGGTGATACAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-2789s21c1
Sequence:CCGGCAGATTGTCTTGCAACTTCAGCTCGAGCTGAAGTTGCAAGACAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005359
VALIDATED
SMAD4 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-1692s1c1
Sequence:CCGGGCTGCTGGAATTGGTGTTGATCTCGAGATCAACACCAATTCCAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-636s1c1
Sequence:CCGGCGAGTTGTATCACCTGGAATTCTCGAGAATTCCAGGTGATACAACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.3-1848s1c1
Sequence:CCGGGTACTTCATACCATGCCGATTCTCGAGAATCGGCATGGTATGAAGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005359.3-2038s1c1
Sequence:CCGGGCAGACAGAAACTGGATTAAACTCGAGTTTAATCCAGTTTCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005359.5-2153s21c1
Sequence:CCGGGTACTTCATACCATGCCGATTCTCGAGAATCGGCATGGTATGAAGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.x-458s1c1
Sequence:CCGGTACCATACAGAGAACATTGGACTCGAGTCCAATGTTCTCTGTATGGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005359.x-1735s1c1
Sequence:CCGGTATGCATACTCAGGATGAGTTCTCGAGAACTCATCCTGAGTATGCATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005359.x-2493s1c1
Sequence:CCGGCAGATTGTCTTGCAACTTCAGCTCGAGCTGAAGTTGCAAGACAATCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-2343s21c1
Sequence:CCGGGCAGACAGAAACTGGATTAAACTCGAGTTTAATCCAGTTTCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-754s21c1
Sequence:CCGGTACCATACAGAGAACATTGGACTCGAGTCCAATGTTCTCTGTATGGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005359.5-941s21c1
Sequence:CCGGCGAGTTGTATCACCTGGAATTCTCGAGAATTCCAGGTGATACAACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005359.5-2789s21c1
Sequence:CCGGCAGATTGTCTTGCAACTTCAGCTCGAGCTGAAGTTGCAAGACAATCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)