EMAIL THIS PAGE TO A FRIEND

SMAD6

SMAD family member 6

88 Gene Product Result for
Synonyms: AOVD2 HsT17432 MADH6 MADH7
Gene ID:
Human(4091) Summary: The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2009]
Mouse(17130) SMAD family member 6
Rat(367100) SMAD family member 6
chicken(374096) SMAD family member 6
Horse(100033852) SMAD family member 6
domestic cat(101095019) SMAD family member 6
dog(487612) SMAD family member 6
naked mole-rat(101714081) SMAD family member 6
domestic guinea pig(100731530) SMAD family member 6
cow(511279) SMAD family member 6
sheep(101103068) SMAD family member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32690 Anti-SMAD6 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, rat, dog, pig, human, bovine
immunohistochemistry, western blot pricing
SAB4200383 Anti-SMAD6 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4200384 Anti-SMAD6 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1412513 ANTI-SMAD6 antibody produced in mouse clone 4F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412514 ANTI-SMAD6 antibody produced in mouse clone 2A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412515 ANTI-SMAD6 antibody produced in mouse clone 4F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412516 ANTI-SMAD6 antibody produced in mouse clone 2A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412517 ANTI-SMAD6 antibody produced in mouse clone 2E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412518 ANTI-SMAD6 antibody produced in mouse clone 1G2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
HPA061917 Anti-SMAD6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2103533 Anti-SMAD6, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0004091M7 Monoclonal Anti-SMAD6 antibody produced in mouse clone 4F4, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005585 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005585 Rosetta Predictions human pricing
NM_001109002 Rosetta Predictions rat pricing
NM_008542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072113 predicted 1990
2 SASI_Hs01_00072114 predicted 1838
3 SASI_Hs01_00072115 predicted 2112
4 SASI_Hs02_00339870 predicted 1831
5 SASI_Hs01_00072116 predicted 1828
6 SASI_Hs02_00339871 predicted 1915
7 SASI_Hs01_00072118 predicted 1884
8 SASI_Hs01_00072119 predicted 1845
9 SASI_Hs01_00072120 predicted 1881
10 SASI_Hs01_00072121 predicted 1853
11 SASI_Hs01_00072117 predicted 1879
12 SASI_Hs01_00072122 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244204 predicted 1571
2 SASI_Rn02_00244205 predicted 1723
3 SASI_Rn02_00244206 predicted 1556
4 SASI_Rn02_00244207 predicted 713
5 SASI_Rn02_00244208 predicted 723
6 SASI_Rn02_00244209 predicted 837
7 SASI_Rn02_00244210 predicted 1608
8 SASI_Rn02_00244211 predicted 1730
9 SASI_Rn02_00244212 predicted 1613
10 SASI_Rn02_00244213 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074100 predicted 1173
2 SASI_Mm01_00074101 predicted 1329
3 SASI_Mm01_00074102 predicted 1586
4 SASI_Mm01_00074103 predicted 1609
5 SASI_Mm01_00074104 predicted 1166
6 SASI_Mm01_00074105 predicted 321
7 SASI_Mm02_00314140 predicted 1354
8 SASI_Mm01_00074107 predicted 1219
9 SASI_Mm01_00074108 predicted 1154
10 SASI_Mm01_00074109 predicted 463
11 SASI_Mm01_00074106 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008542
VALIDATED
SMAD6 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1764s1c1
Sequence:CCGGCCTACTCAACAACCACAGATACTCGAGTATCTGTGGTTGTTGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1755s1c1
Sequence:CCGGGCTGGAGATCCTACTCAACAACTCGAGTTGTTGAGTAGGATCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1876s1c1
Sequence:CCGGCCAGATATCATCTACCTAGATCTCGAGATCTAGGTAGATGATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1179s1c1
Sequence:CCGGGTCCGATTCTACATTGTCTTACTCGAGTAAGACAATGTAGAATCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008542.2-2014s21c1
Sequence:CCGGAGACGCACTTTGGCTTGTAATCTCGAGATTACAAGCCAAAGTGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1181s1c1
Sequence:CCGGCCGATTCTACATTGTCTTACACTCGAGTGTAAGACAATGTAGAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.3-2087s21c1
Sequence:CCGGACGACCAGGCTGTCAGCATTTCTCGAGAAATGCTGACAGCCTGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008542.3-2616s21c1
Sequence:CCGGAGATATCATCTACCTAGATTTCTCGAGAAATCTAGGTAGATGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1755s21c1
Sequence:CCGGGCTGGAGATCCTACTCAACAACTCGAGTTGTTGAGTAGGATCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008542.2-1614s21c1
Sequence:CCGGGTTCGACTTTGAGCGCTCATGCTCGAGCATGAGCGCTCAAAGTCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1226s21c1
Sequence:CCGGTCATCACTGCTCCGGGTGAATCTCGAGATTCACCCGGAGCAGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1179s21c1
Sequence:CCGGGTCCGATTCTACATTGTCTTACTCGAGTAAGACAATGTAGAATCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008542
VALIDATED
SMAD6 MISSION shRNA shRNA Plasmid DNA
SMAD family member 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1764s1c1
Sequence:CCGGCCTACTCAACAACCACAGATACTCGAGTATCTGTGGTTGTTGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1755s1c1
Sequence:CCGGGCTGGAGATCCTACTCAACAACTCGAGTTGTTGAGTAGGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1876s1c1
Sequence:CCGGCCAGATATCATCTACCTAGATCTCGAGATCTAGGTAGATGATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1179s1c1
Sequence:CCGGGTCCGATTCTACATTGTCTTACTCGAGTAAGACAATGTAGAATCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008542.2-2014s21c1
Sequence:CCGGAGACGCACTTTGGCTTGTAATCTCGAGATTACAAGCCAAAGTGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1181s1c1
Sequence:CCGGCCGATTCTACATTGTCTTACACTCGAGTGTAAGACAATGTAGAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.3-2087s21c1
Sequence:CCGGACGACCAGGCTGTCAGCATTTCTCGAGAAATGCTGACAGCCTGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008542.3-2616s21c1
Sequence:CCGGAGATATCATCTACCTAGATTTCTCGAGAAATCTAGGTAGATGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1755s21c1
Sequence:CCGGGCTGGAGATCCTACTCAACAACTCGAGTTGTTGAGTAGGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008542.2-1614s21c1
Sequence:CCGGGTTCGACTTTGAGCGCTCATGCTCGAGCATGAGCGCTCAAAGTCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1226s21c1
Sequence:CCGGTCATCACTGCTCCGGGTGAATCTCGAGATTCACCCGGAGCAGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1179s21c1
Sequence:CCGGGTCCGATTCTACATTGTCTTACTCGAGTAAGACAATGTAGAATCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008542
VALIDATED
SMAD6 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1764s1c1
Sequence:CCGGCCTACTCAACAACCACAGATACTCGAGTATCTGTGGTTGTTGAGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1755s1c1
Sequence:CCGGGCTGGAGATCCTACTCAACAACTCGAGTTGTTGAGTAGGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1876s1c1
Sequence:CCGGCCAGATATCATCTACCTAGATCTCGAGATCTAGGTAGATGATATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1179s1c1
Sequence:CCGGGTCCGATTCTACATTGTCTTACTCGAGTAAGACAATGTAGAATCGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008542.2-2014s21c1
Sequence:CCGGAGACGCACTTTGGCTTGTAATCTCGAGATTACAAGCCAAAGTGCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008542.2-1181s1c1
Sequence:CCGGCCGATTCTACATTGTCTTACACTCGAGTGTAAGACAATGTAGAATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.3-2087s21c1
Sequence:CCGGACGACCAGGCTGTCAGCATTTCTCGAGAAATGCTGACAGCCTGGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008542.3-2616s21c1
Sequence:CCGGAGATATCATCTACCTAGATTTCTCGAGAAATCTAGGTAGATGATATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1755s21c1
Sequence:CCGGGCTGGAGATCCTACTCAACAACTCGAGTTGTTGAGTAGGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008542.2-1614s21c1
Sequence:CCGGGTTCGACTTTGAGCGCTCATGCTCGAGCATGAGCGCTCAAAGTCGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1226s21c1
Sequence:CCGGTCATCACTGCTCCGGGTGAATCTCGAGATTCACCCGGAGCAGTGATGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008542.2-1179s21c1
Sequence:CCGGGTCCGATTCTACATTGTCTTACTCGAGTAAGACAATGTAGAATCGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005585
VALIDATED
SMAD6 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005585.2-1823s1c1
Sequence:CCGGCCACATTGTCTTACACTGAAACTCGAGTTTCAGTGTAAGACAATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-1832s1c1
Sequence:CCGGCTTACACTGAAACGGAGGCTACTCGAGTAGCCTCCGTTTCAGTGTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-2394s1c1
Sequence:CCGGCTGGCTGGAGATCCTCCTCAACTCGAGTTGAGGAGGATCTCCAGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-967s1c1
Sequence:CCGGCGGCGACTTTGGCGAAGTCGTCTCGAGACGACTTCGCCAAAGTCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005585.2-2238s1c1
Sequence:CCGGCTCCATCAAGGTGTTCGACTTCTCGAGAAGTCGAACACCTTGATGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1866s21c1
Sequence:CCGGTGAAACGGAGGCTACCAACTCCTCGAGGAGTTGGTAGCCTCCGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-2265s21c1
Sequence:CCGGCTCCATCAAGGTGTTCGACTTCTCGAGAAGTCGAACACCTTGATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005585.3-2562s21c1
Sequence:CCGGAGATATCATCTACCTAGATTTCTCGAGAAATCTAGGTAGATGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1889s21c1
Sequence:CCGGTCATCACTGCTCCGGGTGAATCTCGAGATTCACCCGGAGCAGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1843s21c1
Sequence:CCGGTCCGATTCCACATTGTCTTACCTCGAGGTAAGACAATGTGGAATCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005585
VALIDATED
SMAD6 MISSION shRNA shRNA Plasmid DNA
SMAD family member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005585.2-1823s1c1
Sequence:CCGGCCACATTGTCTTACACTGAAACTCGAGTTTCAGTGTAAGACAATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-1832s1c1
Sequence:CCGGCTTACACTGAAACGGAGGCTACTCGAGTAGCCTCCGTTTCAGTGTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-2394s1c1
Sequence:CCGGCTGGCTGGAGATCCTCCTCAACTCGAGTTGAGGAGGATCTCCAGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-967s1c1
Sequence:CCGGCGGCGACTTTGGCGAAGTCGTCTCGAGACGACTTCGCCAAAGTCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005585.2-2238s1c1
Sequence:CCGGCTCCATCAAGGTGTTCGACTTCTCGAGAAGTCGAACACCTTGATGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1866s21c1
Sequence:CCGGTGAAACGGAGGCTACCAACTCCTCGAGGAGTTGGTAGCCTCCGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-2265s21c1
Sequence:CCGGCTCCATCAAGGTGTTCGACTTCTCGAGAAGTCGAACACCTTGATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005585.3-2562s21c1
Sequence:CCGGAGATATCATCTACCTAGATTTCTCGAGAAATCTAGGTAGATGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1889s21c1
Sequence:CCGGTCATCACTGCTCCGGGTGAATCTCGAGATTCACCCGGAGCAGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1843s21c1
Sequence:CCGGTCCGATTCCACATTGTCTTACCTCGAGGTAAGACAATGTGGAATCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005585
VALIDATED
SMAD6 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005585.2-1823s1c1
Sequence:CCGGCCACATTGTCTTACACTGAAACTCGAGTTTCAGTGTAAGACAATGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-1832s1c1
Sequence:CCGGCTTACACTGAAACGGAGGCTACTCGAGTAGCCTCCGTTTCAGTGTAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-2394s1c1
Sequence:CCGGCTGGCTGGAGATCCTCCTCAACTCGAGTTGAGGAGGATCTCCAGCCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005585.2-967s1c1
Sequence:CCGGCGGCGACTTTGGCGAAGTCGTCTCGAGACGACTTCGCCAAAGTCGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005585.2-2238s1c1
Sequence:CCGGCTCCATCAAGGTGTTCGACTTCTCGAGAAGTCGAACACCTTGATGGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1866s21c1
Sequence:CCGGTGAAACGGAGGCTACCAACTCCTCGAGGAGTTGGTAGCCTCCGTTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-2265s21c1
Sequence:CCGGCTCCATCAAGGTGTTCGACTTCTCGAGAAGTCGAACACCTTGATGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005585.3-2562s21c1
Sequence:CCGGAGATATCATCTACCTAGATTTCTCGAGAAATCTAGGTAGATGATATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1889s21c1
Sequence:CCGGTCATCACTGCTCCGGGTGAATCTCGAGATTCACCCGGAGCAGTGATGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005585.3-1843s21c1
Sequence:CCGGTCCGATTCCACATTGTCTTACCTCGAGGTAAGACAATGTGGAATCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)