EMAIL THIS PAGE TO A FRIEND

SMARCB1

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1

65 Gene Product Result for
Synonyms: BAF47 INI1 MRD15 RDT RTPS1 SNF5 SNF5L1 Sfh1p Snr1 hSNFS
Gene ID:
Human(6598) Summary: The protein encoded by this gene is part of a complex that relieves repressive chromatin structures, allowing the transcriptional machinery to access its targets more effectively. The encoded nuclear protein may also bind to and enhance the DNA joining activity of HIV-1 integrase. This gene has been found to be a tumor suppressor, and mutations in it have been associated with malignant rhabdoid tumors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20587) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Rat(361825) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
cow(537412) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
sheep(101110622) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
naked mole-rat(101698715) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
domestic guinea pig(100714615) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
dog(486407) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Horse(100056521) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
domestic cat(101089400) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003073 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007468 Rosetta Predictions human pricing
NM_003073 Rosetta Predictions human pricing
NM_001025728 Rosetta Predictions rat pricing
NM_011418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224616 predicted 971
2 SASI_Hs01_00224617 predicted 947
3 SASI_Hs01_00224619 predicted 1004
4 SASI_Hs01_00224620 predicted 839
5 SASI_Hs02_00305307 predicted 976
6 SASI_Hs01_00224622 predicted 852
7 SASI_Hs01_00224624 predicted 926
8 SASI_Hs02_00305308 predicted 793
9 SASI_Hs01_00224625 predicted 620
10 SASI_Hs02_00305309 predicted 1013
11 SASI_Hs01_00224618 predicted 1136
12 SASI_Hs01_00224621 predicted 1046
13 SASI_Hs01_00224623 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065795 predicted 997
2 SASI_Hs01_00065796 predicted 974
3 SASI_Hs01_00065798 predicted 1035
4 SASI_Hs01_00065799 predicted 871
5 SASI_Hs02_00334992 predicted 1006
6 SASI_Hs01_00065801 predicted 880
7 SASI_Hs01_00065803 predicted 960
8 SASI_Hs02_00334993 predicted 818
9 SASI_Hs01_00065804 predicted 646
10 SASI_Hs02_00334994 predicted 1038
11 SASI_Hs01_00065797 predicted 1162
12 SASI_Hs01_00065800 predicted 1077
13 SASI_Hs01_00065802 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112559 predicted 299
2 SASI_Rn01_00112560 predicted 348
3 SASI_Rn01_00112562 predicted 1279
4 SASI_Rn01_00112564 predicted 1169
5 SASI_Rn01_00112565 predicted 1270
6 SASI_Rn01_00112566 predicted 280
7 SASI_Rn01_00112567 predicted 338
8 SASI_Rn01_00112568 predicted 390
9 SASI_Rn02_00203360 predicted 1181
10 SASI_Rn02_00203361 predicted 998
11 SASI_Rn01_00112561 predicted 945
12 SASI_Rn01_00112563 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095003 predicted 294
2 SASI_Mm01_00095004 predicted 343
3 SASI_Mm01_00095005 predicted 1306
4 SASI_Mm01_00095006 predicted 869
5 SASI_Mm01_00095008 predicted 1017
6 SASI_Mm01_00095009 predicted 226
7 SASI_Mm01_00095010 predicted 282
8 SASI_Mm01_00095011 predicted 948
9 SASI_Mm02_00320636 predicted 1192
10 SASI_Mm02_00320637 predicted 285
11 SASI_Mm01_00095007 predicted 713
12 SASI_Mm01_00095012 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011418
VALIDATED
SMARCB1 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011418.1-1208s1c1
Sequence:CCGGGCCATCCGAAATACCGGAGATCTCGAGATCTCCGGTATTTCGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011418.1-1399s1c1
Sequence:CCGGCCTTCCTCTGTGGAAAGAGAACTCGAGTTCTCTTTCCACAGAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-1297s1c1
Sequence:CCGGAGATAGGAACACAAGGCGAATCTCGAGATTCGCCTTGTGTTCCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-944s1c1
Sequence:CCGGGACAGCATCCTAGAGGATCAACTCGAGTTGATCCTCTAGGATGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-823s1c1
Sequence:CCGGGAAGCTAATGACTCCTGAGATCTCGAGATCTCAGGAGTCATTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-823s21c1
Sequence:CCGGGAAGCTAATGACTCCTGAGATCTCGAGATCTCAGGAGTCATTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011418.1-1356s21c1
Sequence:CCGGGACATCCATGCTCGACCTCTACTCGAGTAGAGGTCGAGCATGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-944s21c1
Sequence:CCGGGACAGCATCCTAGAGGATCAACTCGAGTTGATCCTCTAGGATGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-418s21c1
Sequence:CCGGCACTAAGGATCATGGATATACCTCGAGGTATATCCATGATCCTTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-1297s21c1
Sequence:CCGGAGATAGGAACACAAGGCGAATCTCGAGATTCGCCTTGTGTTCCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011418
VALIDATED
SMARCB1 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011418.1-1208s1c1
Sequence:CCGGGCCATCCGAAATACCGGAGATCTCGAGATCTCCGGTATTTCGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011418.1-1399s1c1
Sequence:CCGGCCTTCCTCTGTGGAAAGAGAACTCGAGTTCTCTTTCCACAGAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-1297s1c1
Sequence:CCGGAGATAGGAACACAAGGCGAATCTCGAGATTCGCCTTGTGTTCCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-944s1c1
Sequence:CCGGGACAGCATCCTAGAGGATCAACTCGAGTTGATCCTCTAGGATGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-823s1c1
Sequence:CCGGGAAGCTAATGACTCCTGAGATCTCGAGATCTCAGGAGTCATTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-823s21c1
Sequence:CCGGGAAGCTAATGACTCCTGAGATCTCGAGATCTCAGGAGTCATTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011418.1-1356s21c1
Sequence:CCGGGACATCCATGCTCGACCTCTACTCGAGTAGAGGTCGAGCATGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-944s21c1
Sequence:CCGGGACAGCATCCTAGAGGATCAACTCGAGTTGATCCTCTAGGATGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-418s21c1
Sequence:CCGGCACTAAGGATCATGGATATACCTCGAGGTATATCCATGATCCTTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-1297s21c1
Sequence:CCGGAGATAGGAACACAAGGCGAATCTCGAGATTCGCCTTGTGTTCCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011418
VALIDATED
SMARCB1 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011418.1-1208s1c1
Sequence:CCGGGCCATCCGAAATACCGGAGATCTCGAGATCTCCGGTATTTCGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011418.1-1399s1c1
Sequence:CCGGCCTTCCTCTGTGGAAAGAGAACTCGAGTTCTCTTTCCACAGAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-1297s1c1
Sequence:CCGGAGATAGGAACACAAGGCGAATCTCGAGATTCGCCTTGTGTTCCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-944s1c1
Sequence:CCGGGACAGCATCCTAGAGGATCAACTCGAGTTGATCCTCTAGGATGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011418.1-823s1c1
Sequence:CCGGGAAGCTAATGACTCCTGAGATCTCGAGATCTCAGGAGTCATTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-823s21c1
Sequence:CCGGGAAGCTAATGACTCCTGAGATCTCGAGATCTCAGGAGTCATTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011418.1-1356s21c1
Sequence:CCGGGACATCCATGCTCGACCTCTACTCGAGTAGAGGTCGAGCATGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-944s21c1
Sequence:CCGGGACAGCATCCTAGAGGATCAACTCGAGTTGATCCTCTAGGATGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-418s21c1
Sequence:CCGGCACTAAGGATCATGGATATACCTCGAGGTATATCCATGATCCTTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011418.1-1297s21c1
Sequence:CCGGAGATAGGAACACAAGGCGAATCTCGAGATTCGCCTTGTGTTCCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003073
VALIDATED
SMARCB1 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003073.2-1457s1c1
Sequence:CCGGCCGGCACACATTCCATTTGTTCTCGAGAACAAATGGAATGTGTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003073.2-777s1c1
Sequence:CCGGGAAGTTGATGACGCCTGAGATCTCGAGATCTCAGGCGTCATCAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003073.2-930s1c1
Sequence:CCGGCGTCATCATCAAGCTGAACATCTCGAGATGTTCAGCTTGATGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-1390s21c1
Sequence:CCGGACGGAGCATCTCAGAAGATTGCTCGAGCAATCTTCTGAGATGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003073.3-870s21c1
Sequence:CCGGCCTCTGTGACGATCTGGATTTCTCGAGAAATCCAGATCGTCACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003073.x-913s1c1
Sequence:CCGGACATGTCAGAGAAGGAGAACCTCGAGGTTCTCCTTCTCTGACATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-837s21c1
Sequence:CCGGGAAGTTGATGACGCCTGAGATCTCGAGATCTCAGGCGTCATCAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-461s21c1
Sequence:CCGGCCACCAGTGTGACCCTGTTAACTCGAGTTAACAGGGTCACACTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-397s21c1
Sequence:CCGGGTTGCATCGTCACATGGTAAACTCGAGTTTACCATGTGACGATGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003073
VALIDATED
SMARCB1 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003073.2-1457s1c1
Sequence:CCGGCCGGCACACATTCCATTTGTTCTCGAGAACAAATGGAATGTGTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003073.2-777s1c1
Sequence:CCGGGAAGTTGATGACGCCTGAGATCTCGAGATCTCAGGCGTCATCAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003073.2-930s1c1
Sequence:CCGGCGTCATCATCAAGCTGAACATCTCGAGATGTTCAGCTTGATGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-1390s21c1
Sequence:CCGGACGGAGCATCTCAGAAGATTGCTCGAGCAATCTTCTGAGATGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003073.3-870s21c1
Sequence:CCGGCCTCTGTGACGATCTGGATTTCTCGAGAAATCCAGATCGTCACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003073.x-913s1c1
Sequence:CCGGACATGTCAGAGAAGGAGAACCTCGAGGTTCTCCTTCTCTGACATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-837s21c1
Sequence:CCGGGAAGTTGATGACGCCTGAGATCTCGAGATCTCAGGCGTCATCAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-461s21c1
Sequence:CCGGCCACCAGTGTGACCCTGTTAACTCGAGTTAACAGGGTCACACTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-397s21c1
Sequence:CCGGGTTGCATCGTCACATGGTAAACTCGAGTTTACCATGTGACGATGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003073
VALIDATED
SMARCB1 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003073.2-1457s1c1
Sequence:CCGGCCGGCACACATTCCATTTGTTCTCGAGAACAAATGGAATGTGTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003073.2-777s1c1
Sequence:CCGGGAAGTTGATGACGCCTGAGATCTCGAGATCTCAGGCGTCATCAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003073.2-930s1c1
Sequence:CCGGCGTCATCATCAAGCTGAACATCTCGAGATGTTCAGCTTGATGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-1390s21c1
Sequence:CCGGACGGAGCATCTCAGAAGATTGCTCGAGCAATCTTCTGAGATGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003073.3-870s21c1
Sequence:CCGGCCTCTGTGACGATCTGGATTTCTCGAGAAATCCAGATCGTCACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003073.x-913s1c1
Sequence:CCGGACATGTCAGAGAAGGAGAACCTCGAGGTTCTCCTTCTCTGACATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-837s21c1
Sequence:CCGGGAAGTTGATGACGCCTGAGATCTCGAGATCTCAGGCGTCATCAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-461s21c1
Sequence:CCGGCCACCAGTGTGACCCTGTTAACTCGAGTTAACAGGGTCACACTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003073.3-397s21c1
Sequence:CCGGGTTGCATCGTCACATGGTAAACTCGAGTTTACCATGTGACGATGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)