EMAIL THIS PAGE TO A FRIEND

SMARCC1

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1

201 Gene Product Result for
Synonyms: BAF155 CRACC1 Rsc8 SRG3 SWI3
UniProtKB ID: Q92922, Q17RS0, Q6P172, Q8IWH2
Gene ID:
Human(6599) Summary: The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]
Mouse(20588) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Rat(301020) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
chicken(420378) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Horse(100064492) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
domestic cat(101098204) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
dog(476640) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
domestic guinea pig(100720739) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
naked mole-rat(101706151) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
cow(522045) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
sheep(101121808) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003074 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003074 Rosetta Predictions human pricing
NM_001106861 Rosetta Predictions rat pricing
NM_009211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078442 predicted 1726
2 SASI_Hs02_00334995 predicted 2301
3 SASI_Hs01_00078443 predicted 2033
4 SASI_Hs01_00078444 predicted 2633
5 SASI_Hs01_00078445 predicted 1905
6 SASI_Hs01_00078446 predicted 1155
7 SASI_Hs01_00078447 predicted 828
8 SASI_Hs01_00078448 predicted 2055
9 SASI_Hs01_00078449 predicted 2198
10 SASI_Hs01_00078450 predicted 680
11 SASI_Hs01_00078451 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223126 predicted 1991
2 SASI_Rn02_00223127 predicted 587
3 SASI_Rn02_00223128 predicted 1447
4 SASI_Rn02_00223129 predicted 1528
5 SASI_Rn02_00223130 predicted 1812
6 SASI_Rn02_00223131 predicted 798
7 SASI_Rn02_00223132 predicted 2001
8 SASI_Rn02_00223133 predicted 556
9 SASI_Rn02_00223134 predicted 568
10 SASI_Rn02_00223135 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040642 predicted 1118
2 SASI_Mm01_00040645 predicted 573
3 SASI_Mm02_00315610 predicted 2282
4 SASI_Mm01_00040646 predicted 1858
5 SASI_Mm01_00040647 predicted 806
6 SASI_Mm01_00040648 predicted 1922
7 SASI_Mm01_00040649 predicted 561
8 SASI_Mm01_00040650 predicted 1131
9 SASI_Mm01_00040651 predicted 2771
10 SASI_Mm02_00315611 predicted 1417
11 SASI_Mm01_00040643 predicted 569
12 SASI_Mm01_00040644 predicted 1568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003074
VALIDATED
SMARCC1 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-726s21c1
Sequence:CCGGCCCACCACATTTACCCATATTCTCGAGAATATGGGTAAATGTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-834s21c1
Sequence:CCGGGCTATGATACTTGGGTCCATACTCGAGTATGGACCCAAGTATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-199s21c1
Sequence:CCGGCCTAGCTGTTTATCGACGGAACTCGAGTTCCGTCGATAAACAGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003074.3-4561s21c1
Sequence:CCGGGCAGGATATTAGCTCCTTATACTCGAGTATAAGGAGCTAATATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-2807s21c1
Sequence:CCGGGCTCTCTTGGTTGAGACACAACTCGAGTTGTGTCTCAACCAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-835s1c1
Sequence:CCGGGCTATGATACTTGGGTCCATACTCGAGTATGGACCCAAGTATCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-2808s1c1
Sequence:CCGGGCTCTCTTGGTTGAGACACAACTCGAGTTGTGTCTCAACCAAGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-200s1c1
Sequence:CCGGCCTAGCTGTTTATCGACGGAACTCGAGTTCCGTCGATAAACAGCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003074
VALIDATED
SMARCC1 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-726s21c1
Sequence:CCGGCCCACCACATTTACCCATATTCTCGAGAATATGGGTAAATGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-834s21c1
Sequence:CCGGGCTATGATACTTGGGTCCATACTCGAGTATGGACCCAAGTATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-199s21c1
Sequence:CCGGCCTAGCTGTTTATCGACGGAACTCGAGTTCCGTCGATAAACAGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003074.3-4561s21c1
Sequence:CCGGGCAGGATATTAGCTCCTTATACTCGAGTATAAGGAGCTAATATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-2807s21c1
Sequence:CCGGGCTCTCTTGGTTGAGACACAACTCGAGTTGTGTCTCAACCAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-835s1c1
Sequence:CCGGGCTATGATACTTGGGTCCATACTCGAGTATGGACCCAAGTATCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-2808s1c1
Sequence:CCGGGCTCTCTTGGTTGAGACACAACTCGAGTTGTGTCTCAACCAAGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-200s1c1
Sequence:CCGGCCTAGCTGTTTATCGACGGAACTCGAGTTCCGTCGATAAACAGCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003074
VALIDATED
SMARCC1 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-726s21c1
Sequence:CCGGCCCACCACATTTACCCATATTCTCGAGAATATGGGTAAATGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-834s21c1
Sequence:CCGGGCTATGATACTTGGGTCCATACTCGAGTATGGACCCAAGTATCATAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-199s21c1
Sequence:CCGGCCTAGCTGTTTATCGACGGAACTCGAGTTCCGTCGATAAACAGCTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003074.3-4561s21c1
Sequence:CCGGGCAGGATATTAGCTCCTTATACTCGAGTATAAGGAGCTAATATCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003074.3-2807s21c1
Sequence:CCGGGCTCTCTTGGTTGAGACACAACTCGAGTTGTGTCTCAACCAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-835s1c1
Sequence:CCGGGCTATGATACTTGGGTCCATACTCGAGTATGGACCCAAGTATCATAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-2808s1c1
Sequence:CCGGGCTCTCTTGGTTGAGACACAACTCGAGTTGTGTCTCAACCAAGAGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003074.2-200s1c1
Sequence:CCGGCCTAGCTGTTTATCGACGGAACTCGAGTTCCGTCGATAAACAGCTAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009211
SMARCC1 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1780s1c1
Sequence:CCGGGCCGCTCAACAGATGTTAAATCTCGAGATTTAACATCTGTTGAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1009s1c1
Sequence:CCGGGCCAACTCTAGGAAGAGGAAACTCGAGTTTCCTCTTCCTAGAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1585s1c1
Sequence:CCGGCGGTTAAACCTGACTGGAGATCTCGAGATCTCCAGTCAGGTTTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-2881s1c1
Sequence:CCGGCAGTTGAAATATGCTGAACTACTCGAGTAGTTCAGCATATTTCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1501s1c1
Sequence:CCGGCCTGAAATATACTTGGCATATCTCGAGATATGCCAAGTATATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009211
SMARCC1 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1780s1c1
Sequence:CCGGGCCGCTCAACAGATGTTAAATCTCGAGATTTAACATCTGTTGAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1009s1c1
Sequence:CCGGGCCAACTCTAGGAAGAGGAAACTCGAGTTTCCTCTTCCTAGAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1585s1c1
Sequence:CCGGCGGTTAAACCTGACTGGAGATCTCGAGATCTCCAGTCAGGTTTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-2881s1c1
Sequence:CCGGCAGTTGAAATATGCTGAACTACTCGAGTAGTTCAGCATATTTCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1501s1c1
Sequence:CCGGCCTGAAATATACTTGGCATATCTCGAGATATGCCAAGTATATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009211
SMARCC1 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1780s1c1
Sequence:CCGGGCCGCTCAACAGATGTTAAATCTCGAGATTTAACATCTGTTGAGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1009s1c1
Sequence:CCGGGCCAACTCTAGGAAGAGGAAACTCGAGTTTCCTCTTCCTAGAGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1585s1c1
Sequence:CCGGCGGTTAAACCTGACTGGAGATCTCGAGATCTCCAGTCAGGTTTAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-2881s1c1
Sequence:CCGGCAGTTGAAATATGCTGAACTACTCGAGTAGTTCAGCATATTTCAACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009211.1-1501s1c1
Sequence:CCGGCCTGAAATATACTTGGCATATCTCGAGATATGCCAAGTATATTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)