EMAIL THIS PAGE TO A FRIEND

SMARCD1

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1

147 Gene Product Result for
Synonyms: BAF60A CRACD1 Rsc6p
UniProtKB ID: Q96GM5, A6NN27, Q92924, Q9Y635
Gene ID:
Human(6602) Summary: The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(83797) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Rat(363002) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
domestic guinea pig(100720641) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
naked mole-rat(101704168) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
cow(533232) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
sheep(101120315) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Zebrafish(323115) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
domestic cat(101086157) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
dog(486548) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
chicken(426882) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003076 Rosetta Predictions human pricing
NM_139071 Rosetta Predictions human pricing
NM_001108752 Rosetta Predictions rat pricing
NM_031842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144869 predicted 1971
2 SASI_Hs01_00144872 predicted 1869
3 SASI_Hs01_00144873 predicted 1997
4 SASI_Hs01_00144874 predicted 914
5 SASI_Hs01_00144875 predicted 1984
6 SASI_Hs02_00334998 predicted 1128
7 SASI_Hs02_00334999 predicted 1204
8 SASI_Hs01_00144876 predicted 1846
9 SASI_Hs01_00144877 predicted 1106
10 SASI_Hs01_00144878 predicted 812
11 SASI_Hs01_00144870 predicted 656
12 SASI_Hs01_00144871 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051578 predicted 1844
2 SASI_Hs01_00051581 predicted 1749
3 SASI_Hs01_00051582 predicted 1874
4 SASI_Hs01_00051583 predicted 918
5 SASI_Hs01_00051584 predicted 1862
6 SASI_Hs02_00364127 predicted 1127
7 SASI_Hs02_00364128 predicted 1212
8 SASI_Hs01_00051585 predicted 1718
9 SASI_Hs01_00051586 predicted 1102
10 SASI_Hs01_00051587 predicted 814
11 SASI_Hs01_00051579 predicted 652
12 SASI_Hs01_00051580 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241735 predicted 1105
2 SASI_Rn02_00241736 predicted 1260
3 SASI_Rn02_00241737 predicted 1312
4 SASI_Rn02_00241738 predicted 646
5 SASI_Rn02_00241739 predicted 464
6 SASI_Rn02_00241740 predicted 1126
7 SASI_Rn02_00241741 predicted 1262
8 SASI_Rn02_00241742 predicted 412
9 SASI_Rn02_00241743 predicted 300
10 SASI_Rn02_00241744 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035696 predicted 1343
2 SASI_Mm01_00035695 predicted 1230
3 SASI_Mm01_00035697 predicted 541
4 SASI_Mm01_00035698 predicted 965
5 SASI_Mm01_00035699 predicted 381
6 SASI_Mm01_00035702 predicted 860
7 SASI_Mm01_00035703 predicted 1305
8 SASI_Mm01_00035704 predicted 1223
9 SASI_Mm02_00337176 predicted 1075
10 SASI_Mm02_00337177 predicted 524
11 SASI_Mm01_00035700 predicted 286
12 SASI_Mm01_00035701 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003076
VALIDATED
SMARCD1 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-887s21c1
Sequence:CCGGCTTGGTGATTGAACTGGACAACTCGAGTTGTCCAGTTCAATCACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1176s1c1
Sequence:CCGGGATCTTTGAGTCTCAACGTATCTCGAGATACGTTGAGACTCAAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1413s1c1
Sequence:CCGGCCATGAGACAATAGAAACCATCTCGAGATGGTTTCTATTGTCTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1712s1c1
Sequence:CCGGCGACTGCACCAATTCTTGATTCTCGAGAATCAAGAATTGGTGCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-858s1c1
Sequence:CCGGCTTGGTGATTGAACTGGACAACTCGAGTTGTCCAGTTCAATCACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1381s1c1
Sequence:CCGGCAACAGGAGATTGCTACTCTACTCGAGTAGAGTAGCAATCTCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003076.3-892s1c1
Sequence:CCGGCCAGACAACCATCTGGTAGAACTCGAGTTCTACCAGATGGTTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1614s1c1
Sequence:CCGGGTGCCGATACTTCTACTCCAACTCGAGTTGGAGTAGAAGTATCGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-573s1c1
Sequence:CCGGCCAGGCCTATATGGATCTCTTCTCGAGAAGAGATCCATATAGGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003076.4-1741s21c1
Sequence:CCGGCGACTGCACCAATTCTTGATTCTCGAGAATCAAGAATTGGTGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-653s21c1
Sequence:CCGGCATGAGGAAACGGCTAGATATCTCGAGATATCTAGCCGTTTCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-968s1c1
Sequence:CCGGGAGACGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-624s1c1
Sequence:CCGGCATGAGGAAACGGCTAGATATCTCGAGATATCTAGCCGTTTCCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-1205s21c1
Sequence:CCGGGATCTTTGAGTCTCAACGTATCTCGAGATACGTTGAGACTCAAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003076
VALIDATED
SMARCD1 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-887s21c1
Sequence:CCGGCTTGGTGATTGAACTGGACAACTCGAGTTGTCCAGTTCAATCACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1176s1c1
Sequence:CCGGGATCTTTGAGTCTCAACGTATCTCGAGATACGTTGAGACTCAAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1413s1c1
Sequence:CCGGCCATGAGACAATAGAAACCATCTCGAGATGGTTTCTATTGTCTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1712s1c1
Sequence:CCGGCGACTGCACCAATTCTTGATTCTCGAGAATCAAGAATTGGTGCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-858s1c1
Sequence:CCGGCTTGGTGATTGAACTGGACAACTCGAGTTGTCCAGTTCAATCACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1381s1c1
Sequence:CCGGCAACAGGAGATTGCTACTCTACTCGAGTAGAGTAGCAATCTCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003076.3-892s1c1
Sequence:CCGGCCAGACAACCATCTGGTAGAACTCGAGTTCTACCAGATGGTTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1614s1c1
Sequence:CCGGGTGCCGATACTTCTACTCCAACTCGAGTTGGAGTAGAAGTATCGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-573s1c1
Sequence:CCGGCCAGGCCTATATGGATCTCTTCTCGAGAAGAGATCCATATAGGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003076.4-1741s21c1
Sequence:CCGGCGACTGCACCAATTCTTGATTCTCGAGAATCAAGAATTGGTGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-653s21c1
Sequence:CCGGCATGAGGAAACGGCTAGATATCTCGAGATATCTAGCCGTTTCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-968s1c1
Sequence:CCGGGAGACGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-624s1c1
Sequence:CCGGCATGAGGAAACGGCTAGATATCTCGAGATATCTAGCCGTTTCCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-1205s21c1
Sequence:CCGGGATCTTTGAGTCTCAACGTATCTCGAGATACGTTGAGACTCAAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003076
VALIDATED
SMARCD1 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-887s21c1
Sequence:CCGGCTTGGTGATTGAACTGGACAACTCGAGTTGTCCAGTTCAATCACCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1176s1c1
Sequence:CCGGGATCTTTGAGTCTCAACGTATCTCGAGATACGTTGAGACTCAAAGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1413s1c1
Sequence:CCGGCCATGAGACAATAGAAACCATCTCGAGATGGTTTCTATTGTCTCATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1712s1c1
Sequence:CCGGCGACTGCACCAATTCTTGATTCTCGAGAATCAAGAATTGGTGCAGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-858s1c1
Sequence:CCGGCTTGGTGATTGAACTGGACAACTCGAGTTGTCCAGTTCAATCACCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1381s1c1
Sequence:CCGGCAACAGGAGATTGCTACTCTACTCGAGTAGAGTAGCAATCTCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003076.3-892s1c1
Sequence:CCGGCCAGACAACCATCTGGTAGAACTCGAGTTCTACCAGATGGTTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-1614s1c1
Sequence:CCGGGTGCCGATACTTCTACTCCAACTCGAGTTGGAGTAGAAGTATCGGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-573s1c1
Sequence:CCGGCCAGGCCTATATGGATCTCTTCTCGAGAAGAGATCCATATAGGCCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003076.4-1741s21c1
Sequence:CCGGCGACTGCACCAATTCTTGATTCTCGAGAATCAAGAATTGGTGCAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-653s21c1
Sequence:CCGGCATGAGGAAACGGCTAGATATCTCGAGATATCTAGCCGTTTCCTCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-968s1c1
Sequence:CCGGGAGACGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACGTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003076.3-624s1c1
Sequence:CCGGCATGAGGAAACGGCTAGATATCTCGAGATATCTAGCCGTTTCCTCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003076.4-1205s21c1
Sequence:CCGGGATCTTTGAGTCTCAACGTATCTCGAGATACGTTGAGACTCAAAGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031842
VALIDATED
SMARCD1 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-500s21c1
Sequence:CCGGGAAACTGGACCAGACTATTATCTCGAGATAATAGTCTGGTCCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-862s21c1
Sequence:CCGGGAGATGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-2407s21c1
Sequence:CCGGGCCTGAAATCAAACGGGTAAACTCGAGTTTACCCGTTTGATTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-984s21c1
Sequence:CCGGCAAGCACTGTGGCAGTATATTCTCGAGAATATACTGCCACAGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-1346s21c1
Sequence:CCGGGCGAGAGTTCATGTTGAGCTTCTCGAGAAGCTCAACATGAACTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1515s1c1
Sequence:CCGGCCTGGGAATCCGAAACACATACTCGAGTATGTGTTTCGGATTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1302s1c1
Sequence:CCGGGCGAGAGTTCATGTTGAGCTTCTCGAGAAGCTCAACATGAACTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1041s1c1
Sequence:CCGGGCGGATGAAGTTCTCAGAGATCTCGAGATCTCTGAGAACTTCATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-818s1c1
Sequence:CCGGGAGATGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-2358s1c1
Sequence:CCGGGCCTGAAATCAAACGGGTAAACTCGAGTTTACCCGTTTGATTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031842
VALIDATED
SMARCD1 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-500s21c1
Sequence:CCGGGAAACTGGACCAGACTATTATCTCGAGATAATAGTCTGGTCCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-862s21c1
Sequence:CCGGGAGATGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-2407s21c1
Sequence:CCGGGCCTGAAATCAAACGGGTAAACTCGAGTTTACCCGTTTGATTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-984s21c1
Sequence:CCGGCAAGCACTGTGGCAGTATATTCTCGAGAATATACTGCCACAGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-1346s21c1
Sequence:CCGGGCGAGAGTTCATGTTGAGCTTCTCGAGAAGCTCAACATGAACTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1515s1c1
Sequence:CCGGCCTGGGAATCCGAAACACATACTCGAGTATGTGTTTCGGATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1302s1c1
Sequence:CCGGGCGAGAGTTCATGTTGAGCTTCTCGAGAAGCTCAACATGAACTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1041s1c1
Sequence:CCGGGCGGATGAAGTTCTCAGAGATCTCGAGATCTCTGAGAACTTCATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-818s1c1
Sequence:CCGGGAGATGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-2358s1c1
Sequence:CCGGGCCTGAAATCAAACGGGTAAACTCGAGTTTACCCGTTTGATTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031842
VALIDATED
SMARCD1 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-500s21c1
Sequence:CCGGGAAACTGGACCAGACTATTATCTCGAGATAATAGTCTGGTCCAGTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-862s21c1
Sequence:CCGGGAGATGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-2407s21c1
Sequence:CCGGGCCTGAAATCAAACGGGTAAACTCGAGTTTACCCGTTTGATTTCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-984s21c1
Sequence:CCGGCAAGCACTGTGGCAGTATATTCTCGAGAATATACTGCCACAGTGCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031842.2-1346s21c1
Sequence:CCGGGCGAGAGTTCATGTTGAGCTTCTCGAGAAGCTCAACATGAACTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1515s1c1
Sequence:CCGGCCTGGGAATCCGAAACACATACTCGAGTATGTGTTTCGGATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1302s1c1
Sequence:CCGGGCGAGAGTTCATGTTGAGCTTCTCGAGAAGCTCAACATGAACTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-1041s1c1
Sequence:CCGGGCGGATGAAGTTCTCAGAGATCTCGAGATCTCTGAGAACTTCATCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-818s1c1
Sequence:CCGGGAGATGTGAATGTACGGTGTACTCGAGTACACCGTACATTCACATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031842.1-2358s1c1
Sequence:CCGGGCCTGAAATCAAACGGGTAAACTCGAGTTTACCCGTTTGATTTCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)