EMAIL THIS PAGE TO A FRIEND

SMARCD2

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2

165 Gene Product Result for
Synonyms: BAF60B CRACD2 Rsc6p
Gene ID:
Human(6603) Summary: The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(83796) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Rat(83833) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Zebrafish(564317) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
domestic cat(101097605) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
chicken(428275) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
dog(480477) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
cow(789613) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
sheep(101104326) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
naked mole-rat(101711033) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
domestic guinea pig(100717449) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
ABE1318 Anti-SMARCD2 (BAF60B) Anti-SMARCD2 (BAF60B), Cat. No. ABE1318, is a highly specific rabbit polyclonal antibody that targets SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 2 and has been tested for use in Immunocytochemistry, Immunohistochemistry (Paraffin), and Western Blotti human, human
immunocytochemistry, immunohistochemistry, western blot pricing
AV38223 Anti-SMARCD2 antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, bovine, dog, human, horse, rabbit
immunohistochemistry, western blot pricing
HPA059934 Anti-SMARCD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA061348 Anti-SMARCD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0006603M1 Monoclonal Anti-SMARCD2 antibody produced in mouse clone 2F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404379 Monoclonal Anti-SMARCD2 antibody produced in mouse clone 2B2, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB1409685 Monoclonal Anti-SMARCD2 antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003077 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098426 Rosetta Predictions human pricing
NM_003077 Rosetta Predictions human pricing
NM_031983 Rosetta Predictions rat pricing
NM_001130187 Rosetta Predictions mouse pricing
NM_031878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318919 predicted 1891
2 SASI_Hs02_00318920 predicted 1904
3 SASI_Hs02_00318921 predicted 1156
4 SASI_Hs02_00318922 predicted 724
5 SASI_Hs02_00318923 predicted 1640
6 SASI_Hs02_00318924 predicted 1756
7 SASI_Hs02_00318925 predicted 886
8 SASI_Hs02_00318926 predicted 1385
9 SASI_Hs02_00318927 predicted 1753
10 SASI_Hs02_00318928 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335000 predicted 1824
2 SASI_Hs01_00183564 predicted 1842
3 SASI_Hs01_00183565 predicted 1095
4 SASI_Hs01_00183566 predicted 660
5 SASI_Hs01_00183567 predicted 1581
6 SASI_Hs01_00183568 predicted 1690
7 SASI_Hs01_00183569 predicted 827
8 SASI_Hs01_00183570 predicted 1316
9 SASI_Hs01_00183571 predicted 1694
10 SASI_Hs02_00335001 predicted 1365
11 SASI_Hs01_00183562 predicted 673
12 SASI_Hs01_00183563 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121214 predicted 1439
2 SASI_Rn01_00121215 predicted 668
3 SASI_Rn01_00121218 predicted 1294
4 SASI_Rn01_00121219 predicted 1084
5 SASI_Rn01_00121221 predicted 1145
6 SASI_Rn02_00265380 predicted 1408
7 SASI_Rn01_00121222 predicted 881
8 SASI_Rn01_00121223 predicted 630
9 SASI_Rn02_00265381 predicted 403
10 SASI_Rn02_00265382 predicted 1245
11 SASI_Rn01_00121216 predicted 1665
12 SASI_Rn01_00121217 predicted 495
13 SASI_Rn01_00121220 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311078 predicted 682
2 SASI_Mm02_00311079 predicted 842
3 SASI_Mm02_00311080 predicted 1466
4 SASI_Mm02_00311081 predicted 1027
5 SASI_Mm02_00311082 predicted 1433
6 SASI_Mm02_00311083 predicted 668
7 SASI_Mm02_00311084 predicted 1263
8 SASI_Mm02_00311085 predicted 1378
9 SASI_Mm02_00311086 predicted 814
10 SASI_Mm02_00311087 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188159 predicted 312
2 SASI_Mm01_00188160 predicted 475
3 SASI_Mm01_00188161 predicted 1103
4 SASI_Mm01_00188162 predicted 661
5 SASI_Mm01_00188163 predicted 1065
6 SASI_Mm01_00188164 predicted 306
7 SASI_Mm01_00188165 predicted 903
8 SASI_Mm01_00188166 predicted 1011
9 SASI_Mm01_00188167 predicted 447
10 SASI_Mm01_00188168 predicted 1249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003077
VALIDATED
SMARCD2 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-1301s1c1
Sequence:CCGGGCGGGAGTACATCAACTGCAACTCGAGTTGCAGTTGATGTACTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003077.2-833s1c1
Sequence:CCGGGCTTCGGATCTACATTTCCAACTCGAGTTGGAAATGTAGATCCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-583s1c1
Sequence:CCGGCCATGATGGATCCATTCCGAACTCGAGTTCGGAATGGATCCATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-722s1c1
Sequence:CCGGTCAGGCGTACATGGATCTCTTCTCGAGAAGAGATCCATGTACGCCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003077.2-1691s1c1
Sequence:CCGGCAAGATCATCACTGATGTGATCTCGAGATCACATCAGTGATGATCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-1301s21c1
Sequence:CCGGGCGGGAGTACATCAACTGCAACTCGAGTTGCAGTTGATGTACTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-722s21c1
Sequence:CCGGTCAGGCGTACATGGATCTCTTCTCGAGAAGAGATCCATGTACGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-583s21c1
Sequence:CCGGCCATGATGGATCCATTCCGAACTCGAGTTCGGAATGGATCCATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-833s21c1
Sequence:CCGGGCTTCGGATCTACATTTCCAACTCGAGTTGGAAATGTAGATCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003077
VALIDATED
SMARCD2 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-1301s1c1
Sequence:CCGGGCGGGAGTACATCAACTGCAACTCGAGTTGCAGTTGATGTACTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003077.2-833s1c1
Sequence:CCGGGCTTCGGATCTACATTTCCAACTCGAGTTGGAAATGTAGATCCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-583s1c1
Sequence:CCGGCCATGATGGATCCATTCCGAACTCGAGTTCGGAATGGATCCATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-722s1c1
Sequence:CCGGTCAGGCGTACATGGATCTCTTCTCGAGAAGAGATCCATGTACGCCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003077.2-1691s1c1
Sequence:CCGGCAAGATCATCACTGATGTGATCTCGAGATCACATCAGTGATGATCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-1301s21c1
Sequence:CCGGGCGGGAGTACATCAACTGCAACTCGAGTTGCAGTTGATGTACTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-722s21c1
Sequence:CCGGTCAGGCGTACATGGATCTCTTCTCGAGAAGAGATCCATGTACGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-583s21c1
Sequence:CCGGCCATGATGGATCCATTCCGAACTCGAGTTCGGAATGGATCCATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-833s21c1
Sequence:CCGGGCTTCGGATCTACATTTCCAACTCGAGTTGGAAATGTAGATCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003077
VALIDATED
SMARCD2 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-1301s1c1
Sequence:CCGGGCGGGAGTACATCAACTGCAACTCGAGTTGCAGTTGATGTACTCCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003077.2-833s1c1
Sequence:CCGGGCTTCGGATCTACATTTCCAACTCGAGTTGGAAATGTAGATCCGAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-583s1c1
Sequence:CCGGCCATGATGGATCCATTCCGAACTCGAGTTCGGAATGGATCCATCATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003077.2-722s1c1
Sequence:CCGGTCAGGCGTACATGGATCTCTTCTCGAGAAGAGATCCATGTACGCCTGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003077.2-1691s1c1
Sequence:CCGGCAAGATCATCACTGATGTGATCTCGAGATCACATCAGTGATGATCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-1301s21c1
Sequence:CCGGGCGGGAGTACATCAACTGCAACTCGAGTTGCAGTTGATGTACTCCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-722s21c1
Sequence:CCGGTCAGGCGTACATGGATCTCTTCTCGAGAAGAGATCCATGTACGCCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-583s21c1
Sequence:CCGGCCATGATGGATCCATTCCGAACTCGAGTTCGGAATGGATCCATCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003077.3-833s21c1
Sequence:CCGGGCTTCGGATCTACATTTCCAACTCGAGTTGGAAATGTAGATCCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031878
VALIDATED
SMARCD2 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031878.2-899s21c1
Sequence:CCGGCACTGTGGCTTTACATCAAACCTCGAGGTTTGATGTAAAGCCACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031878.1-936s1c1
Sequence:CCGGCGCGAGTACATCAACTGCAATCTCGAGATTGCAGTTGATGTACTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031878.1-468s1c1
Sequence:CCGGCTTCGGATCTATATTTCCAATCTCGAGATTGGAAATATAGATCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031878.1-944s1c1
Sequence:CCGGCATCAACTGCAATCGTTACTTCTCGAGAAGTAACGATTGCAGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031878.2-1325s21c1
Sequence:CCGGGCCGAGACCTCAAGATCATCACTCGAGTGATGATCTTGAGGTCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031878
VALIDATED
SMARCD2 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031878.2-899s21c1
Sequence:CCGGCACTGTGGCTTTACATCAAACCTCGAGGTTTGATGTAAAGCCACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031878.1-936s1c1
Sequence:CCGGCGCGAGTACATCAACTGCAATCTCGAGATTGCAGTTGATGTACTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031878.1-468s1c1
Sequence:CCGGCTTCGGATCTATATTTCCAATCTCGAGATTGGAAATATAGATCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031878.1-944s1c1
Sequence:CCGGCATCAACTGCAATCGTTACTTCTCGAGAAGTAACGATTGCAGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031878.2-1325s21c1
Sequence:CCGGGCCGAGACCTCAAGATCATCACTCGAGTGATGATCTTGAGGTCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031878
VALIDATED
SMARCD2 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031878.2-899s21c1
Sequence:CCGGCACTGTGGCTTTACATCAAACCTCGAGGTTTGATGTAAAGCCACAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031878.1-936s1c1
Sequence:CCGGCGCGAGTACATCAACTGCAATCTCGAGATTGCAGTTGATGTACTCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031878.1-468s1c1
Sequence:CCGGCTTCGGATCTATATTTCCAATCTCGAGATTGGAAATATAGATCCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031878.1-944s1c1
Sequence:CCGGCATCAACTGCAATCGTTACTTCTCGAGAAGTAACGATTGCAGTTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031878.2-1325s21c1
Sequence:CCGGGCCGAGACCTCAAGATCATCACTCGAGTGATGATCTTGAGGTCTCGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)