EMAIL THIS PAGE TO A FRIEND

SMC6

structural maintenance of chromosomes 6

73 Gene Product Result for
Synonyms: SMC-6 SMC6L1 hSMC6
UniProtKB ID: Q96SB8, A8K8Q6, D6W518, Q05BV4, Q9H0X3, Q9H6M0
Gene ID:
Mouse(67241) structural maintenance of chromosomes 6
Rat(313961) structural maintenance of chromosomes 6
Zebrafish(797304) structural maintenance of chromosomes 6
Horse(100072064) structural maintenance of chromosomes 6
domestic cat(101082813) structural maintenance of chromosomes 6
dog(475675) structural maintenance of chromosomes 6
chicken(421950) structural maintenance of chromosomes 6
cow(510381) structural maintenance of chromosomes 6
sheep(101123020) structural maintenance of chromosomes 6
domestic guinea pig(100721259) structural maintenance of chromosomes 6
Domestic Rabbit(100354764) structural maintenance of chromosomes 6
naked mole-rat(101718055) structural maintenance of chromosomes 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024624 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024624 Rosetta Predictions human pricing
NM_001108014 Rosetta Predictions rat pricing
NM_025695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035976 predicted 3009
2 SASI_Hs01_00035977 predicted 2105
3 SASI_Hs01_00035978 predicted 1898
4 SASI_Hs01_00035979 predicted 2870
5 SASI_Hs01_00035980 predicted 2723
6 SASI_Hs01_00035983 predicted 3233
7 SASI_Hs01_00035984 predicted 433
8 SASI_Hs01_00035985 predicted 1966
9 SASI_Hs02_00357004 predicted 301
10 SASI_Hs02_00357005 predicted 1972
11 SASI_Hs01_00035981 predicted 952
12 SASI_Hs01_00035982 predicted 2952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234515 predicted 3318
2 SASI_Rn02_00234516 predicted 2085
3 SASI_Rn02_00234517 predicted 2506
4 SASI_Rn02_00234518 predicted 1422
5 SASI_Rn02_00234519 predicted 3206
6 SASI_Rn02_00234520 predicted 2101
7 SASI_Rn02_00234521 predicted 1739
8 SASI_Rn02_00234522 predicted 1707
9 SASI_Rn02_00234523 predicted 2532
10 SASI_Rn02_00234524 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065545 predicted 3606
2 SASI_Mm02_00328857 predicted 935
3 SASI_Mm01_00065546 predicted 1296
4 SASI_Mm01_00065547 predicted 2360
5 SASI_Mm01_00065548 predicted 2014
6 SASI_Mm01_00065550 predicted 2352
7 SASI_Mm01_00065551 predicted 3231
8 SASI_Mm02_00328858 predicted 1722
9 SASI_Mm01_00065553 predicted 3485
10 SASI_Mm02_00328859 predicted 1119
11 SASI_Mm01_00065544 predicted 1089
12 SASI_Mm01_00065549 predicted 587
13 SASI_Mm01_00065552 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024624
SMC6 MISSION shRNA Bacterial Glycerol Stock
structural maintenance of chromosomes 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-1878s21c1
Sequence:CCGGACCTCACGGCCACCGATAATACTCGAGTATTATCGGTGGCCGTGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-1997s21c1
Sequence:CCGGGGTTGTGGCAAATAGCCTAATCTCGAGATTAGGCTATTTGCCACAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-3232s1c1
Sequence:CCGGCCTGGATGAATTTGATGTCTACTCGAGTAGACATCAAATTCATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-1067s1c1
Sequence:CCGGGCCATCAGAGATAATATCAAACTCGAGTTTGATATTATCTCTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-2783s1c1
Sequence:CCGGGCATCAATTCTGGACAAAGAACTCGAGTTCTTTGTCCAGAATTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024624.4-3993s1c1
Sequence:CCGGCACCCTACCAAGAGCTTATAACTCGAGTTATAAGCTCTTGGTAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.4-1275s1c1
Sequence:CCGGACCGATCCTTAAACGAATATACTCGAGTATATTCGTTTAAGGATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-653s21c1
Sequence:CCGGAGATGGAAGTCGATCTTATAACTCGAGTTATAAGATCGACTTCCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-2913s21c1
Sequence:CCGGTATCTTGATCTGGATAGTAAACTCGAGTTTACTATCCAGATCAAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-2030s21c1
Sequence:CCGGCATAGAGACAGTGCTACTAATCTCGAGATTAGTAGCACTGTCTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024624
SMC6 MISSION shRNA shRNA Plasmid DNA
structural maintenance of chromosomes 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-1878s21c1
Sequence:CCGGACCTCACGGCCACCGATAATACTCGAGTATTATCGGTGGCCGTGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-1997s21c1
Sequence:CCGGGGTTGTGGCAAATAGCCTAATCTCGAGATTAGGCTATTTGCCACAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-3232s1c1
Sequence:CCGGCCTGGATGAATTTGATGTCTACTCGAGTAGACATCAAATTCATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-1067s1c1
Sequence:CCGGGCCATCAGAGATAATATCAAACTCGAGTTTGATATTATCTCTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-2783s1c1
Sequence:CCGGGCATCAATTCTGGACAAAGAACTCGAGTTCTTTGTCCAGAATTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024624.4-3993s1c1
Sequence:CCGGCACCCTACCAAGAGCTTATAACTCGAGTTATAAGCTCTTGGTAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.4-1275s1c1
Sequence:CCGGACCGATCCTTAAACGAATATACTCGAGTATATTCGTTTAAGGATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-653s21c1
Sequence:CCGGAGATGGAAGTCGATCTTATAACTCGAGTTATAAGATCGACTTCCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-2913s21c1
Sequence:CCGGTATCTTGATCTGGATAGTAAACTCGAGTTTACTATCCAGATCAAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-2030s21c1
Sequence:CCGGCATAGAGACAGTGCTACTAATCTCGAGATTAGTAGCACTGTCTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024624
SMC6 MISSION shRNA Lentiviral Transduction Particles
structural maintenance of chromosomes 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-1878s21c1
Sequence:CCGGACCTCACGGCCACCGATAATACTCGAGTATTATCGGTGGCCGTGAGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-1997s21c1
Sequence:CCGGGGTTGTGGCAAATAGCCTAATCTCGAGATTAGGCTATTTGCCACAACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000182889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-3232s1c1
Sequence:CCGGCCTGGATGAATTTGATGTCTACTCGAGTAGACATCAAATTCATCCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-1067s1c1
Sequence:CCGGGCCATCAGAGATAATATCAAACTCGAGTTTGATATTATCTCTGATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.2-2783s1c1
Sequence:CCGGGCATCAATTCTGGACAAAGAACTCGAGTTCTTTGTCCAGAATTGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024624.4-3993s1c1
Sequence:CCGGCACCCTACCAAGAGCTTATAACTCGAGTTATAAGCTCTTGGTAGGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024624.4-1275s1c1
Sequence:CCGGACCGATCCTTAAACGAATATACTCGAGTATATTCGTTTAAGGATCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-653s21c1
Sequence:CCGGAGATGGAAGTCGATCTTATAACTCGAGTTATAAGATCGACTTCCATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-2913s21c1
Sequence:CCGGTATCTTGATCTGGATAGTAAACTCGAGTTTACTATCCAGATCAAGATATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024624.5-2030s21c1
Sequence:CCGGCATAGAGACAGTGCTACTAATCTCGAGATTAGTAGCACTGTCTCTATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025695
SMC6 MISSION shRNA Bacterial Glycerol Stock
structural maintenance of chromosomes 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-459s1c1
Sequence:CCGGCGTGGATGGAAGTCGATCTTACTCGAGTAAGATCGACTTCCATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-2720s1c1
Sequence:CCGGCCTACCTTGATCTGGATAATACTCGAGTATTATCCAGATCAAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1356s1c1
Sequence:CCGGCCGAGTTAGGAAAGAAGATATCTCGAGATATCTTCTTTCCTAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1507s1c1
Sequence:CCGGCGGAGACAATTTACCCATAAACTCGAGTTTATGGGTAAATTGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1093s1c1
Sequence:CCGGGCCTTTAATGACGCTGAGGTTCTCGAGAACCTCAGCGTCATTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025695
SMC6 MISSION shRNA shRNA Plasmid DNA
structural maintenance of chromosomes 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-459s1c1
Sequence:CCGGCGTGGATGGAAGTCGATCTTACTCGAGTAAGATCGACTTCCATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-2720s1c1
Sequence:CCGGCCTACCTTGATCTGGATAATACTCGAGTATTATCCAGATCAAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1356s1c1
Sequence:CCGGCCGAGTTAGGAAAGAAGATATCTCGAGATATCTTCTTTCCTAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1507s1c1
Sequence:CCGGCGGAGACAATTTACCCATAAACTCGAGTTTATGGGTAAATTGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1093s1c1
Sequence:CCGGGCCTTTAATGACGCTGAGGTTCTCGAGAACCTCAGCGTCATTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025695
SMC6 MISSION shRNA Lentiviral Transduction Particles
structural maintenance of chromosomes 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-459s1c1
Sequence:CCGGCGTGGATGGAAGTCGATCTTACTCGAGTAAGATCGACTTCCATCCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-2720s1c1
Sequence:CCGGCCTACCTTGATCTGGATAATACTCGAGTATTATCCAGATCAAGGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1356s1c1
Sequence:CCGGCCGAGTTAGGAAAGAAGATATCTCGAGATATCTTCTTTCCTAACTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1507s1c1
Sequence:CCGGCGGAGACAATTTACCCATAAACTCGAGTTTATGGGTAAATTGTCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025695.2-1093s1c1
Sequence:CCGGGCCTTTAATGACGCTGAGGTTCTCGAGAACCTCAGCGTCATTAAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???