EMAIL THIS PAGE TO A FRIEND

SMG6

SMG6 nonsense mediated mRNA decay factor

65 Gene Product Result for
Synonyms: C17orf31 EST1A SMG-6 hSMG5/7a
UniProtKB ID: Q86US8, B7Z874, O94837, Q86VH6, Q9UF60
Gene ID:
Human(23293) Summary: This gene encodes a protein which is part of the telomerase ribonucleoprotein complex and binds single-stranded DNA found at the telomeres, but the product of this gene also participates in the nonsense-mediated mRNA decay (NMD) pathway. The encoded protein contains two binding sites for components of the exon junction complex (EJC); interaction between the encoded protein and the EJC is necessary for NMD activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(103677) Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Rat(287522) SMG6 nonsense mediated mRNA decay factor
cow(516411) smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
sheep(101117944) smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
domestic guinea pig(100715692) smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
naked mole-rat(101703882) smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
fruit fly(42994) CG6369 gene product from transcript CG6369-RA
Horse(100060172) smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Zebrafish(100302521) Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
chicken(771628) Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
domestic cat(101099159) smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
dog(491199) smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042932 Anti-SMG6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017575 Rosetta Predictions human pricing
NM_001105808 Rosetta Predictions rat pricing
NM_001002764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123782 predicted 329
2 SASI_Hs02_00350229 predicted 2755
3 SASI_Hs01_00123783 predicted 1619
4 SASI_Hs01_00123784 predicted 2468
5 SASI_Hs01_00123785 predicted 1535
6 SASI_Hs01_00123786 predicted 1655
7 SASI_Hs01_00123787 predicted 3075
8 SASI_Hs01_00123788 predicted 1911
9 SASI_Hs01_00123790 predicted 4048
10 SASI_Hs02_00350230 predicted 1360
11 SASI_Hs01_00123789 predicted 912
12 SASI_Hs01_00123791 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212736 predicted 844
2 SASI_Rn02_00212737 predicted 2145
3 SASI_Rn02_00212738 predicted 3277
4 SASI_Rn02_00212739 predicted 4780
5 SASI_Rn02_00212740 predicted 3596
6 SASI_Rn02_00212741 predicted 942
7 SASI_Rn02_00212742 predicted 3380
8 SASI_Rn02_00212743 predicted 2891
9 SASI_Rn02_00212744 predicted 1683
10 SASI_Rn02_00212745 predicted 4759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084088 predicted 2747
2 SASI_Mm01_00084089 predicted 208
3 SASI_Mm01_00084090 predicted 2867
4 SASI_Mm02_00286293 predicted 3236
5 SASI_Mm01_00084092 predicted 2194
6 SASI_Mm02_00286294 predicted 559
7 SASI_Mm01_00084093 predicted 2885
8 SASI_Mm01_00084094 predicted 2161
9 SASI_Mm01_00084095 predicted 1223
10 SASI_Mm01_00084096 predicted 301
11 SASI_Mm01_00084087 predicted 607
12 SASI_Mm01_00084091 predicted 1165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002764
VALIDATED
SMG6 MISSION shRNA Bacterial Glycerol Stock
SMG6 nonsense mediated mRNA decay factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002764.1-4214s21c1
Sequence:CCGGTGATCGGAACCTTCGTGTAAACTCGAGTTTACACGAAGGTTCCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002764.1-4393s21c1
Sequence:CCGGTACCAATCCACCCAGACAATACTCGAGTATTGTCTGGGTGGATTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002764.1-5428s1c1
Sequence:CCGGCCTCTGTTTACAACCTCACTTCTCGAGAAGTGAGGTTGTAAACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-584s21c1
Sequence:CCGGGTGTAAGGGAGAAGCTATAAACTCGAGTTTATAGCTTCTCCCTTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-1521s1c1
Sequence:CCGGGCCCAAGCATCTTACTATAAACTCGAGTTTATAGTAAGATGCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-609s1c1
Sequence:CCGGGAAGTTAATAACAAACCGGATCTCGAGATCCGGTTTGTTATTAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-428s1c1
Sequence:CCGGCCGAAGTCTAAAGATCATCAACTCGAGTTGATGATCTTTAGACTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-2993s21c1
Sequence:CCGGGCGCTGCACATGCCTACTTAACTCGAGTTAAGTAGGCATGTGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-1629s21c1
Sequence:CCGGTACCCAGTAGGCCCTACAAATCTCGAGATTTGTAGGGCCTACTGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002764
VALIDATED
SMG6 MISSION shRNA shRNA Plasmid DNA
SMG6 nonsense mediated mRNA decay factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002764.1-4214s21c1
Sequence:CCGGTGATCGGAACCTTCGTGTAAACTCGAGTTTACACGAAGGTTCCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002764.1-4393s21c1
Sequence:CCGGTACCAATCCACCCAGACAATACTCGAGTATTGTCTGGGTGGATTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002764.1-5428s1c1
Sequence:CCGGCCTCTGTTTACAACCTCACTTCTCGAGAAGTGAGGTTGTAAACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-584s21c1
Sequence:CCGGGTGTAAGGGAGAAGCTATAAACTCGAGTTTATAGCTTCTCCCTTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-1521s1c1
Sequence:CCGGGCCCAAGCATCTTACTATAAACTCGAGTTTATAGTAAGATGCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-609s1c1
Sequence:CCGGGAAGTTAATAACAAACCGGATCTCGAGATCCGGTTTGTTATTAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-428s1c1
Sequence:CCGGCCGAAGTCTAAAGATCATCAACTCGAGTTGATGATCTTTAGACTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-2993s21c1
Sequence:CCGGGCGCTGCACATGCCTACTTAACTCGAGTTAAGTAGGCATGTGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-1629s21c1
Sequence:CCGGTACCCAGTAGGCCCTACAAATCTCGAGATTTGTAGGGCCTACTGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002764
VALIDATED
SMG6 MISSION shRNA Lentiviral Transduction Particles
SMG6 nonsense mediated mRNA decay factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002764.1-4214s21c1
Sequence:CCGGTGATCGGAACCTTCGTGTAAACTCGAGTTTACACGAAGGTTCCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002764.1-4393s21c1
Sequence:CCGGTACCAATCCACCCAGACAATACTCGAGTATTGTCTGGGTGGATTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002764.1-5428s1c1
Sequence:CCGGCCTCTGTTTACAACCTCACTTCTCGAGAAGTGAGGTTGTAAACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-584s21c1
Sequence:CCGGGTGTAAGGGAGAAGCTATAAACTCGAGTTTATAGCTTCTCCCTTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-1521s1c1
Sequence:CCGGGCCCAAGCATCTTACTATAAACTCGAGTTTATAGTAAGATGCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-609s1c1
Sequence:CCGGGAAGTTAATAACAAACCGGATCTCGAGATCCGGTTTGTTATTAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002764.1-428s1c1
Sequence:CCGGCCGAAGTCTAAAGATCATCAACTCGAGTTGATGATCTTTAGACTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-2993s21c1
Sequence:CCGGGCGCTGCACATGCCTACTTAACTCGAGTTAAGTAGGCATGTGCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002764.1-1629s21c1
Sequence:CCGGTACCCAGTAGGCCCTACAAATCTCGAGATTTGTAGGGCCTACTGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017575
VALIDATED
SMG6 MISSION shRNA Bacterial Glycerol Stock
SMG6 nonsense mediated mRNA decay factor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017575.x-4799s1c1
Sequence:CCGGCATGAACCCAAGTCGGCTTCTCTCGAGAGAAGCCGACTTGGGTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-3007s21c1
Sequence:CCGGCCGCTGCACCTGCTTACTTAACTCGAGTTAAGTAAGCAGGTGCAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-618s21c1
Sequence:CCGGAGGAGGAAGTTGCGAATAAACCTCGAGGTTTATTCGCAACTTCCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017575.3-5516s1c1
Sequence:CCGGGCCAGAGACAAGGACAACTTACTCGAGTAAGTTGTCCTTGTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-741s1c1
Sequence:CCGGCGCTCAGACAAACGAAGGAATCTCGAGATTCCTTCGTTTGTCTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-3725s1c1
Sequence:CCGGGCTCGAAATCAGACCTTTGTTCTCGAGAACAAAGGTCTGATTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017575.3-281s1c1
Sequence:CCGGGCCCGTTAAAGATGTCTGCAACTCGAGTTGCAGACATCTTTAACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-2081s1c1
Sequence:CCGGGCAGGTTACTTACAAGTTCAACTCGAGTTGAACTTGTAAGTAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-2403s21c1
Sequence:CCGGTTGACGCTGTCTATTACTATACTCGAGTATAGTAATAGACAGCGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-433s21c1
Sequence:CCGGACAAGAGGATCGTAGTCTAAACTCGAGTTTAGACTACGATCCTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-2279s21c1
Sequence:CCGGGCCAGTGATACAGCGAATTATCTCGAGATAATTCGCTGTATCACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017575
VALIDATED
SMG6 MISSION shRNA shRNA Plasmid DNA
SMG6 nonsense mediated mRNA decay factor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017575.x-4799s1c1
Sequence:CCGGCATGAACCCAAGTCGGCTTCTCTCGAGAGAAGCCGACTTGGGTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-3007s21c1
Sequence:CCGGCCGCTGCACCTGCTTACTTAACTCGAGTTAAGTAAGCAGGTGCAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-618s21c1
Sequence:CCGGAGGAGGAAGTTGCGAATAAACCTCGAGGTTTATTCGCAACTTCCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017575.3-5516s1c1
Sequence:CCGGGCCAGAGACAAGGACAACTTACTCGAGTAAGTTGTCCTTGTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-741s1c1
Sequence:CCGGCGCTCAGACAAACGAAGGAATCTCGAGATTCCTTCGTTTGTCTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-3725s1c1
Sequence:CCGGGCTCGAAATCAGACCTTTGTTCTCGAGAACAAAGGTCTGATTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017575.3-281s1c1
Sequence:CCGGGCCCGTTAAAGATGTCTGCAACTCGAGTTGCAGACATCTTTAACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-2081s1c1
Sequence:CCGGGCAGGTTACTTACAAGTTCAACTCGAGTTGAACTTGTAAGTAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-2403s21c1
Sequence:CCGGTTGACGCTGTCTATTACTATACTCGAGTATAGTAATAGACAGCGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-433s21c1
Sequence:CCGGACAAGAGGATCGTAGTCTAAACTCGAGTTTAGACTACGATCCTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-2279s21c1
Sequence:CCGGGCCAGTGATACAGCGAATTATCTCGAGATAATTCGCTGTATCACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017575
VALIDATED
SMG6 MISSION shRNA Lentiviral Transduction Particles
SMG6 nonsense mediated mRNA decay factor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017575.x-4799s1c1
Sequence:CCGGCATGAACCCAAGTCGGCTTCTCTCGAGAGAAGCCGACTTGGGTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-3007s21c1
Sequence:CCGGCCGCTGCACCTGCTTACTTAACTCGAGTTAAGTAAGCAGGTGCAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-618s21c1
Sequence:CCGGAGGAGGAAGTTGCGAATAAACCTCGAGGTTTATTCGCAACTTCCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017575.3-5516s1c1
Sequence:CCGGGCCAGAGACAAGGACAACTTACTCGAGTAAGTTGTCCTTGTCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-741s1c1
Sequence:CCGGCGCTCAGACAAACGAAGGAATCTCGAGATTCCTTCGTTTGTCTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-3725s1c1
Sequence:CCGGGCTCGAAATCAGACCTTTGTTCTCGAGAACAAAGGTCTGATTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017575.3-281s1c1
Sequence:CCGGGCCCGTTAAAGATGTCTGCAACTCGAGTTGCAGACATCTTTAACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017575.3-2081s1c1
Sequence:CCGGGCAGGTTACTTACAAGTTCAACTCGAGTTGAACTTGTAAGTAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-2403s21c1
Sequence:CCGGTTGACGCTGTCTATTACTATACTCGAGTATAGTAATAGACAGCGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-433s21c1
Sequence:CCGGACAAGAGGATCGTAGTCTAAACTCGAGTTTAGACTACGATCCTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017575.4-2279s21c1
Sequence:CCGGGCCAGTGATACAGCGAATTATCTCGAGATAATTCGCTGTATCACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)