EMAIL THIS PAGE TO A FRIEND

SMIM15

small integral membrane protein 15

32 Gene Product Result for
Synonyms: C5orf43
UniProtKB ID: Q7Z3B0, B9EJC4
Gene ID:
Mouse(75616) small integral membrane protein 15
Rat(100359861) small integral membrane protein 15
domestic guinea pig(100720022) small integral membrane protein 15
naked mole-rat(101723196) small integral membrane protein 15
Zebrafish(556945) small integral membrane protein 15
dog(100684940) small integral membrane protein 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001048249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001048249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001048249 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001048250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001048250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001048250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048249 Rosetta Predictions human pricing
XM_926525 Rosetta Predictions human pricing
NM_001048250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311812 predicted 845
2 SASI_Hs02_00311813 predicted 830
3 SASI_Hs02_00311814 predicted 782
4 SASI_Hs02_00311815 predicted 707
5 SASI_Hs02_00311816 predicted 702
6 SASI_Hs02_00311817 predicted 730
7 SASI_Hs02_00311818 predicted 847
8 SASI_Hs02_00311819 predicted 788
9 SASI_Hs02_00311820 predicted 752
10 SASI_Hs02_00311821 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269154 predicted 844
2 SASI_Hs01_00269155 predicted 1046
3 SASI_Hs01_00269156 predicted 1040
4 SASI_Hs01_00269157 predicted 1079
5 SASI_Hs01_00269158 predicted 732
6 SASI_Hs01_00269159 predicted 818
7 SASI_Hs01_00269160 predicted 709
8 SASI_Hs01_00269161 predicted 697
9 SASI_Hs01_00269162 predicted 735
10 SASI_Hs01_00269163 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292289 predicted 485
2 SASI_Mm02_00292290 predicted 504
3 SASI_Mm02_00292291 predicted 584
4 SASI_Mm02_00292292 predicted 596
5 SASI_Mm02_00292293 predicted 596
6 SASI_Mm02_00292294 predicted 465
7 SASI_Mm02_00292295 predicted 509
8 SASI_Mm02_00292296 predicted 452
9 SASI_Mm02_00292297 predicted 767
10 SASI_Mm02_00292298 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048249
VALIDATED
SMIM15 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 15
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-488s21c1
Sequence:CCGGGGCTTCCTTACAACCGTTATTCTCGAGAATAACGGTTGTAAGGAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048249.3-2361s21c1
Sequence:CCGGGCAAAGGATATAGTCATAATTCTCGAGAATTATGACTATATCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-650s21c1
Sequence:CCGGTGAAGGACTGAACAGGCTTTGCTCGAGCAAAGCCTGTTCAGTCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-537s21c1
Sequence:CCGGGTGCTGTACTGTCTTGGAAATCTCGAGATTTCCAAGACAGTACAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048249
VALIDATED
SMIM15 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 15
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-488s21c1
Sequence:CCGGGGCTTCCTTACAACCGTTATTCTCGAGAATAACGGTTGTAAGGAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048249.3-2361s21c1
Sequence:CCGGGCAAAGGATATAGTCATAATTCTCGAGAATTATGACTATATCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-650s21c1
Sequence:CCGGTGAAGGACTGAACAGGCTTTGCTCGAGCAAAGCCTGTTCAGTCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-537s21c1
Sequence:CCGGGTGCTGTACTGTCTTGGAAATCTCGAGATTTCCAAGACAGTACAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048249
VALIDATED
SMIM15 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 15
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-488s21c1
Sequence:CCGGGGCTTCCTTACAACCGTTATTCTCGAGAATAACGGTTGTAAGGAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048249.3-2361s21c1
Sequence:CCGGGCAAAGGATATAGTCATAATTCTCGAGAATTATGACTATATCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-650s21c1
Sequence:CCGGTGAAGGACTGAACAGGCTTTGCTCGAGCAAAGCCTGTTCAGTCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001048249.3-537s21c1
Sequence:CCGGGTGCTGTACTGTCTTGGAAATCTCGAGATTTCCAAGACAGTACAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048250
VALIDATED
SMIM15 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1630s21c1
Sequence:CCGGACATGATTTCATGGGTATAACCTCGAGGTTATACCCATGAAATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1064s21c1
Sequence:CCGGTTAACCGGAAGTGAGGTTTACCTCGAGGTAAACCTCACTTCCGGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-830s21c1
Sequence:CCGGATCCCATCCTCAAGGTATTATCTCGAGATAATACCTTGAGGATGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-589s21c1
Sequence:CCGGGGTATCTACTGGCAAGTATTTCTCGAGAAATACTTGCCAGTAGATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1030s21c1
Sequence:CCGGGTTCTAGACAGAGGATATTAGCTCGAGCTAATATCCTCTGTCTAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048250
VALIDATED
SMIM15 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1630s21c1
Sequence:CCGGACATGATTTCATGGGTATAACCTCGAGGTTATACCCATGAAATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1064s21c1
Sequence:CCGGTTAACCGGAAGTGAGGTTTACCTCGAGGTAAACCTCACTTCCGGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-830s21c1
Sequence:CCGGATCCCATCCTCAAGGTATTATCTCGAGATAATACCTTGAGGATGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-589s21c1
Sequence:CCGGGGTATCTACTGGCAAGTATTTCTCGAGAAATACTTGCCAGTAGATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1030s21c1
Sequence:CCGGGTTCTAGACAGAGGATATTAGCTCGAGCTAATATCCTCTGTCTAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048250
VALIDATED
SMIM15 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1630s21c1
Sequence:CCGGACATGATTTCATGGGTATAACCTCGAGGTTATACCCATGAAATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1064s21c1
Sequence:CCGGTTAACCGGAAGTGAGGTTTACCTCGAGGTAAACCTCACTTCCGGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-830s21c1
Sequence:CCGGATCCCATCCTCAAGGTATTATCTCGAGATAATACCTTGAGGATGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-589s21c1
Sequence:CCGGGGTATCTACTGGCAAGTATTTCTCGAGAAATACTTGCCAGTAGATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048250.2-1030s21c1
Sequence:CCGGGTTCTAGACAGAGGATATTAGCTCGAGCTAATATCCTCTGTCTAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)