EMAIL THIS PAGE TO A FRIEND

SMO

smoothened, frizzled family receptor

63 Gene Product Result for
Synonyms: FZD11 Gx SMOH
UniProtKB ID: Q99835
Gene ID:
Human(6608) Summary: The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010]
Mouse(319757) smoothened homolog (Drosophila)
Rat(25273) smoothened, frizzled family receptor
fruit fly(33196) smoothened
domestic cat(101087567) smoothened, frizzled family receptor
Horse(100033990) smoothened, frizzled family receptor
dog(482262) smoothened, frizzled family receptor
Zebrafish(30225) smoothened homolog (Drosophila)
chicken(395949) smoothened, frizzled family receptor
cow(539308) smoothened, frizzled family receptor
sheep(780493) smoothened, frizzled family receptor
domestic guinea pig(100732598) smoothened, frizzled family receptor
naked mole-rat(101710259) smoothened, frizzled family receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
CLLS1110 MCF10A CELLS SMO W535L human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005631 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005631 Rosetta Predictions human pricing
NM_012807 Rosetta Predictions rat pricing
NM_176996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157741 predicted 1063
2 SASI_Hs01_00157742 predicted 1661
3 SASI_Hs01_00157743 predicted 1736
4 SASI_Hs01_00157744 predicted 2737
5 SASI_Hs01_00157745 predicted 840
6 SASI_Hs01_00157747 predicted 1587
7 SASI_Hs01_00157748 predicted 2679
8 SASI_Hs01_00157750 predicted 1841
9 SASI_Hs02_00339963 predicted 662
10 SASI_Hs02_00339964 predicted 2575
11 SASI_Hs01_00157746 predicted 2673
12 SASI_Hs01_00157749 predicted 2687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054948 predicted 1501
2 SASI_Rn01_00054950 predicted 568
3 SASI_Rn01_00054951 predicted 1574
4 SASI_Rn01_00054952 predicted 1998
5 SASI_Rn01_00054953 predicted 1223
6 SASI_Rn01_00054954 predicted 793
7 SASI_Rn01_00054955 predicted 945
8 SASI_Rn01_00054956 predicted 1461
9 SASI_Rn01_00054957 predicted 1186
10 SASI_Rn02_00260249 predicted 2145
11 SASI_Rn01_00054949 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028502 predicted 1745
2 SASI_Mm01_00028503 predicted 2023
3 SASI_Mm02_00346929 predicted 917
4 SASI_Mm01_00028504 predicted 2473
5 SASI_Mm01_00028505 predicted 1316
6 SASI_Mm01_00028507 predicted 2087
7 SASI_Mm01_00028508 predicted 2832
8 SASI_Mm01_00028509 predicted 1971
9 SASI_Mm01_00028510 predicted 2507
10 SASI_Mm01_00028511 predicted 2095
11 SASI_Mm01_00028506 predicted 2922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176996
SMO MISSION shRNA Bacterial Glycerol Stock
smoothened, frizzled family receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-2825s1c1
Sequence:CCGGGATCCATTCATTCCCGCACTACTCGAGTAGTGCGGGAATGAATGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-1578s1c1
Sequence:CCGGCTCGGGCAAGACATCCTATTTCTCGAGAAATAGGATGTCTTGCCCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-2832s21c1
Sequence:CCGGGATCCATTCATTCCCGCACTACTCGAGTAGTGCGGGAATGAATGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176996.3-3470s1c1
Sequence:CCGGCCCTACATTCACATCTCAGTTCTCGAGAACTGAGATGTGAATGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-2199s1c1
Sequence:CCGGCAAGAGAATCAAGAAGAGCAACTCGAGTTGCTCTTCTTGATTCTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-1306s1c1
Sequence:CCGGCCTGCGGTTATTCTCTTCTATCTCGAGATAGAAGAGAATAACCGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-2206s21c1
Sequence:CCGGCAAGAGAATCAAGAAGAGCAACTCGAGTTGCTCTTCTTGATTCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-1313s21c1
Sequence:CCGGCCTGCGGTTATTCTCTTCTATCTCGAGATAGAAGAGAATAACCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176996.4-3477s21c1
Sequence:CCGGCCCTACATTCACATCTCAGTTCTCGAGAACTGAGATGTGAATGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176996
SMO MISSION shRNA shRNA Plasmid DNA
smoothened, frizzled family receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-2825s1c1
Sequence:CCGGGATCCATTCATTCCCGCACTACTCGAGTAGTGCGGGAATGAATGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-1578s1c1
Sequence:CCGGCTCGGGCAAGACATCCTATTTCTCGAGAAATAGGATGTCTTGCCCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-2832s21c1
Sequence:CCGGGATCCATTCATTCCCGCACTACTCGAGTAGTGCGGGAATGAATGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176996.3-3470s1c1
Sequence:CCGGCCCTACATTCACATCTCAGTTCTCGAGAACTGAGATGTGAATGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-2199s1c1
Sequence:CCGGCAAGAGAATCAAGAAGAGCAACTCGAGTTGCTCTTCTTGATTCTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-1306s1c1
Sequence:CCGGCCTGCGGTTATTCTCTTCTATCTCGAGATAGAAGAGAATAACCGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-2206s21c1
Sequence:CCGGCAAGAGAATCAAGAAGAGCAACTCGAGTTGCTCTTCTTGATTCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-1313s21c1
Sequence:CCGGCCTGCGGTTATTCTCTTCTATCTCGAGATAGAAGAGAATAACCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176996.4-3477s21c1
Sequence:CCGGCCCTACATTCACATCTCAGTTCTCGAGAACTGAGATGTGAATGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176996
SMO MISSION shRNA Lentiviral Transduction Particles
smoothened, frizzled family receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-2825s1c1
Sequence:CCGGGATCCATTCATTCCCGCACTACTCGAGTAGTGCGGGAATGAATGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-1578s1c1
Sequence:CCGGCTCGGGCAAGACATCCTATTTCTCGAGAAATAGGATGTCTTGCCCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-2832s21c1
Sequence:CCGGGATCCATTCATTCCCGCACTACTCGAGTAGTGCGGGAATGAATGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176996.3-3470s1c1
Sequence:CCGGCCCTACATTCACATCTCAGTTCTCGAGAACTGAGATGTGAATGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-2199s1c1
Sequence:CCGGCAAGAGAATCAAGAAGAGCAACTCGAGTTGCTCTTCTTGATTCTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176996.3-1306s1c1
Sequence:CCGGCCTGCGGTTATTCTCTTCTATCTCGAGATAGAAGAGAATAACCGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-2206s21c1
Sequence:CCGGCAAGAGAATCAAGAAGAGCAACTCGAGTTGCTCTTCTTGATTCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176996.4-1313s21c1
Sequence:CCGGCCTGCGGTTATTCTCTTCTATCTCGAGATAGAAGAGAATAACCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176996.4-3477s21c1
Sequence:CCGGCCCTACATTCACATCTCAGTTCTCGAGAACTGAGATGTGAATGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005631
SMO MISSION shRNA Bacterial Glycerol Stock
smoothened, frizzled family receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005631.3-3296s1c1
Sequence:CCGGCCAACCTCTTTGCGTTTCCTTCTCGAGAAGGAAACGCAAAGAGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-1228s1c1
Sequence:CCGGCATCTTTGTCATCGTGTACTACTCGAGTAGTACACGATGACAAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-1793s1c1
Sequence:CCGGCCTGACTGTGAGATCAAGAATCTCGAGATTCTTGATCTCACAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-2602s1c1
Sequence:CCGGCCTGATGGACACAGAACTCATCTCGAGATGAGTTCTGTGTCCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1086s21c1
Sequence:CCGGACGTCAATGCGTGCTTCTTTGCTCGAGCAAAGAAGCACGCATTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1428s21c1
Sequence:CCGGGGGACTCTGTGAGTGGCATTTCTCGAGAAATGCCACTCACAGAGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1059s21c1
Sequence:CCGGATCGCTACCCTGCTGTTATTCCTCGAGGAATAACAGCAGGGTAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1839s21c1
Sequence:CCGGTCAACCTGTTTGCCATGTTTGCTCGAGCAAACATGGCAAACAGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005631
SMO MISSION shRNA shRNA Plasmid DNA
smoothened, frizzled family receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005631.3-3296s1c1
Sequence:CCGGCCAACCTCTTTGCGTTTCCTTCTCGAGAAGGAAACGCAAAGAGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-1228s1c1
Sequence:CCGGCATCTTTGTCATCGTGTACTACTCGAGTAGTACACGATGACAAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-1793s1c1
Sequence:CCGGCCTGACTGTGAGATCAAGAATCTCGAGATTCTTGATCTCACAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-2602s1c1
Sequence:CCGGCCTGATGGACACAGAACTCATCTCGAGATGAGTTCTGTGTCCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1086s21c1
Sequence:CCGGACGTCAATGCGTGCTTCTTTGCTCGAGCAAAGAAGCACGCATTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1428s21c1
Sequence:CCGGGGGACTCTGTGAGTGGCATTTCTCGAGAAATGCCACTCACAGAGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1059s21c1
Sequence:CCGGATCGCTACCCTGCTGTTATTCCTCGAGGAATAACAGCAGGGTAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1839s21c1
Sequence:CCGGTCAACCTGTTTGCCATGTTTGCTCGAGCAAACATGGCAAACAGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005631
SMO MISSION shRNA Lentiviral Transduction Particles
smoothened, frizzled family receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005631.3-3296s1c1
Sequence:CCGGCCAACCTCTTTGCGTTTCCTTCTCGAGAAGGAAACGCAAAGAGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-1228s1c1
Sequence:CCGGCATCTTTGTCATCGTGTACTACTCGAGTAGTACACGATGACAAAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-1793s1c1
Sequence:CCGGCCTGACTGTGAGATCAAGAATCTCGAGATTCTTGATCTCACAGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005631.3-2602s1c1
Sequence:CCGGCCTGATGGACACAGAACTCATCTCGAGATGAGTTCTGTGTCCATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1086s21c1
Sequence:CCGGACGTCAATGCGTGCTTCTTTGCTCGAGCAAAGAAGCACGCATTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1428s21c1
Sequence:CCGGGGGACTCTGTGAGTGGCATTTCTCGAGAAATGCCACTCACAGAGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1059s21c1
Sequence:CCGGATCGCTACCCTGCTGTTATTCCTCGAGGAATAACAGCAGGGTAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005631.3-1839s21c1
Sequence:CCGGTCAACCTGTTTGCCATGTTTGCTCGAGCAAACATGGCAAACAGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)