EMAIL THIS PAGE TO A FRIEND

SMPD1

sphingomyelin phosphodiesterase 1, acid lysosomal

154 Gene Product Result for
Synonyms: ASM ASMASE NPD
Gene ID:
Human(6609) Summary: The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
Mouse(20597) sphingomyelin phosphodiesterase 1, acid lysosomal
Rat(308909) sphingomyelin phosphodiesterase 1, acid lysosomal
Zebrafish(556700) sphingomyelin phosphodiesterase 1, acid lysosomal
chicken(419077) sphingomyelin phosphodiesterase 1, acid lysosomal
dog(485334) sphingomyelin phosphodiesterase 1, acid lysosomal
domestic cat(101099497) sphingomyelin phosphodiesterase 1, acid lysosomal
naked mole-rat(101699079) sphingomyelin phosphodiesterase 1, acid lysosomal
Domestic Rabbit(100353898) sphingomyelin phosphodiesterase 1, acid lysosomal
domestic guinea pig(100720041) sphingomyelin phosphodiesterase 1, acid lysosomal
cow(505097) sphingomyelin phosphodiesterase 1, acid lysosomal
sheep(100307047) sphingomyelin phosphodiesterase 1, acid lysosomal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK188 Acid Smase Activity Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000543 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000543 Rosetta Predictions human pricing
NM_001007593 Rosetta Predictions human pricing
NM_001006997 Rosetta Predictions rat pricing
NM_011421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302764 predicted 2123
2 SASI_Hs01_00114309 predicted 1660
3 SASI_Hs01_00114310 predicted 2140
4 SASI_Hs01_00114311 predicted 1014
5 SASI_Hs01_00114313 predicted 1726
6 SASI_Hs01_00114314 predicted 1676
7 SASI_Hs01_00114315 predicted 1800
8 SASI_Hs01_00114316 predicted 2075
9 SASI_Hs01_00114317 predicted 2130
10 SASI_Hs01_00114318 predicted 1640
11 SASI_Hs01_00114312 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305350 predicted 1989
2 SASI_Hs01_00198609 predicted 1527
3 SASI_Hs01_00198610 predicted 2014
4 SASI_Hs01_00198611 predicted 1014
5 SASI_Hs01_00198613 predicted 1598
6 SASI_Hs01_00198614 predicted 1547
7 SASI_Hs01_00198615 predicted 1664
8 SASI_Hs01_00198616 predicted 1948
9 SASI_Hs01_00198617 predicted 1994
10 SASI_Hs01_00198618 predicted 1513
11 SASI_Hs01_00198612 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120995 predicted 448
2 SASI_Rn01_00120996 predicted 2073
3 SASI_Rn01_00120997 predicted 450
4 SASI_Rn01_00120998 predicted 1214
5 SASI_Rn01_00120999 predicted 2068
6 SASI_Rn01_00121000 predicted 1690
7 SASI_Rn01_00121001 predicted 2022
8 SASI_Rn01_00121002 predicted 1354
9 SASI_Rn02_00198580 predicted 364
10 SASI_Rn01_00121003 predicted 2009
11 SASI_Rn01_00121004 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065474 predicted 873
2 SASI_Mm01_00065475 predicted 2062
3 SASI_Mm02_00320640 predicted 314
4 SASI_Mm01_00065476 predicted 1709
5 SASI_Mm01_00065477 predicted 1354
6 SASI_Mm01_00065481 predicted 764
7 SASI_Mm02_00320641 predicted 948
8 SASI_Mm01_00065483 predicted 1927
9 SASI_Mm02_00320642 predicted 1117
10 SASI_Mm02_00320643 predicted 1092
11 SASI_Mm01_00065478 predicted 1994
12 SASI_Mm01_00065479 predicted 401
13 SASI_Mm01_00065480 predicted 1918
14 SASI_Mm01_00065482 predicted 2019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011421
SMPD1 MISSION shRNA Bacterial Glycerol Stock
sphingomyelin phosphodiesterase 1, acid lysosomal
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-2007s21c1
Sequence:CCGGGGAGCCTCCCAGATGCTAATACTCGAGTATTAGCATCTGGGAGGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-928s21c1
Sequence:CCGGGGTGTACTGGACGGGAGATATCTCGAGATATCTCCCGTCCAGTACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1567s21c1
Sequence:CCGGTACAACCTTTATCAACCTTAACTCGAGTTAAGGTTGATAAAGGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-1639s21c1
Sequence:CCGGTAACCCTGGCTACCGAGTTTACTCGAGTAAACTCGGTAGCCAGGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1237s21c1
Sequence:CCGGCCGCCTCATCTCTCTCAATATCTCGAGATATTGAGAGAGATGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1358s1c1
Sequence:CCGGCGAGGAGACAAAGTGCATATACTCGAGTATATGCACTTTGTCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1101s1c1
Sequence:CCGGCCTTCATAAAGGGAAACCAATCTCGAGATTGGTTTCCCTTTATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011421.1-2063s1c1
Sequence:CCGGCTGCTTATCTACCTGAGGCAACTCGAGTTGCCTCAGGTAGATAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1359s1c1
Sequence:CCGGGAGGAGACAAAGTGCATATAACTCGAGTTATATGCACTTTGTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1813s1c1
Sequence:CCGGCCAGACCTTCTGGTTTCTCTACTCGAGTAGAGAAACCAGAAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-823s21c1
Sequence:CCGGTTACTGTGCAGATCCACTTTGCTCGAGCAAAGTGGATCTGCACAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011421.2-2231s21c1
Sequence:CCGGTTATGCCCAGGATCTGGATTACTCGAGTAATCCAGATCCTGGGCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1358s21c1
Sequence:CCGGCGAGGAGACAAAGTGCATATACTCGAGTATATGCACTTTGTCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011421.1-2125s21c1
Sequence:CCGGCGCCTCATGAGAGCTTGTTTGCTCGAGCAAACAAGCTCTCATGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011421
SMPD1 MISSION shRNA shRNA Plasmid DNA
sphingomyelin phosphodiesterase 1, acid lysosomal
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-2007s21c1
Sequence:CCGGGGAGCCTCCCAGATGCTAATACTCGAGTATTAGCATCTGGGAGGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-928s21c1
Sequence:CCGGGGTGTACTGGACGGGAGATATCTCGAGATATCTCCCGTCCAGTACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1567s21c1
Sequence:CCGGTACAACCTTTATCAACCTTAACTCGAGTTAAGGTTGATAAAGGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-1639s21c1
Sequence:CCGGTAACCCTGGCTACCGAGTTTACTCGAGTAAACTCGGTAGCCAGGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1237s21c1
Sequence:CCGGCCGCCTCATCTCTCTCAATATCTCGAGATATTGAGAGAGATGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1358s1c1
Sequence:CCGGCGAGGAGACAAAGTGCATATACTCGAGTATATGCACTTTGTCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1101s1c1
Sequence:CCGGCCTTCATAAAGGGAAACCAATCTCGAGATTGGTTTCCCTTTATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011421.1-2063s1c1
Sequence:CCGGCTGCTTATCTACCTGAGGCAACTCGAGTTGCCTCAGGTAGATAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1359s1c1
Sequence:CCGGGAGGAGACAAAGTGCATATAACTCGAGTTATATGCACTTTGTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1813s1c1
Sequence:CCGGCCAGACCTTCTGGTTTCTCTACTCGAGTAGAGAAACCAGAAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-823s21c1
Sequence:CCGGTTACTGTGCAGATCCACTTTGCTCGAGCAAAGTGGATCTGCACAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011421.2-2231s21c1
Sequence:CCGGTTATGCCCAGGATCTGGATTACTCGAGTAATCCAGATCCTGGGCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1358s21c1
Sequence:CCGGCGAGGAGACAAAGTGCATATACTCGAGTATATGCACTTTGTCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011421.1-2125s21c1
Sequence:CCGGCGCCTCATGAGAGCTTGTTTGCTCGAGCAAACAAGCTCTCATGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011421
SMPD1 MISSION shRNA Lentiviral Transduction Particles
sphingomyelin phosphodiesterase 1, acid lysosomal
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-2007s21c1
Sequence:CCGGGGAGCCTCCCAGATGCTAATACTCGAGTATTAGCATCTGGGAGGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-928s21c1
Sequence:CCGGGGTGTACTGGACGGGAGATATCTCGAGATATCTCCCGTCCAGTACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1567s21c1
Sequence:CCGGTACAACCTTTATCAACCTTAACTCGAGTTAAGGTTGATAAAGGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-1639s21c1
Sequence:CCGGTAACCCTGGCTACCGAGTTTACTCGAGTAAACTCGGTAGCCAGGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1237s21c1
Sequence:CCGGCCGCCTCATCTCTCTCAATATCTCGAGATATTGAGAGAGATGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1358s1c1
Sequence:CCGGCGAGGAGACAAAGTGCATATACTCGAGTATATGCACTTTGTCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1101s1c1
Sequence:CCGGCCTTCATAAAGGGAAACCAATCTCGAGATTGGTTTCCCTTTATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011421.1-2063s1c1
Sequence:CCGGCTGCTTATCTACCTGAGGCAACTCGAGTTGCCTCAGGTAGATAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1359s1c1
Sequence:CCGGGAGGAGACAAAGTGCATATAACTCGAGTTATATGCACTTTGTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011421.1-1813s1c1
Sequence:CCGGCCAGACCTTCTGGTTTCTCTACTCGAGTAGAGAAACCAGAAGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.2-823s21c1
Sequence:CCGGTTACTGTGCAGATCCACTTTGCTCGAGCAAAGTGGATCTGCACAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011421.2-2231s21c1
Sequence:CCGGTTATGCCCAGGATCTGGATTACTCGAGTAATCCAGATCCTGGGCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011421.1-1358s21c1
Sequence:CCGGCGAGGAGACAAAGTGCATATACTCGAGTATATGCACTTTGTCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011421.1-2125s21c1
Sequence:CCGGCGCCTCATGAGAGCTTGTTTGCTCGAGCAAACAAGCTCTCATGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000543
SMPD1 MISSION shRNA Bacterial Glycerol Stock
sphingomyelin phosphodiesterase 1, acid lysosomal
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000543.3-2149s21c1
Sequence:CCGGGGCAAGATCATCCGGTGAAAGCTCGAGCTTTCACCGGATGATCTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1834s21c1
Sequence:CCGGGCCTGGCACAACCTGGTATATCTCGAGATATACCAGGTTGTGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000543.2-2001s1c1
Sequence:CCGGCCCACATTTGGGAAAGTTCTTCTCGAGAAGAACTTTCCCAAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1054s1c1
Sequence:CCGGCCATGAAAGCATACCTGTCAACTCGAGTTGACAGGTATGCTTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1467s1c1
Sequence:CCGGGCCACACTCATGTGGATGAATCTCGAGATTCATCCACATGAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-367s1c1
Sequence:CCGGCCCAATCTGCAAAGGTCTATTCTCGAGAATAGACCTTTGCAGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1225s1c1
Sequence:CCGGCCGCCTCATCTCTCTCAATATCTCGAGATATTGAGAGAGATGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-448s21c1
Sequence:CCGGCCAATCTGCAAAGGTCTATTCCTCGAGGAATAGACCTTTGCAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1427s21c1
Sequence:GTACCGGGAGGAGACAAAGTGCATATAACTCGAGTTATATGCACTTTGTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1636s21c1
Sequence:CCGGACTACCTACATCGGCCTTAATCTCGAGATTAAGGCCGATGTAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000543
SMPD1 MISSION shRNA shRNA Plasmid DNA
sphingomyelin phosphodiesterase 1, acid lysosomal
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000543.3-2149s21c1
Sequence:CCGGGGCAAGATCATCCGGTGAAAGCTCGAGCTTTCACCGGATGATCTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1834s21c1
Sequence:CCGGGCCTGGCACAACCTGGTATATCTCGAGATATACCAGGTTGTGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000543.2-2001s1c1
Sequence:CCGGCCCACATTTGGGAAAGTTCTTCTCGAGAAGAACTTTCCCAAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1054s1c1
Sequence:CCGGCCATGAAAGCATACCTGTCAACTCGAGTTGACAGGTATGCTTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1467s1c1
Sequence:CCGGGCCACACTCATGTGGATGAATCTCGAGATTCATCCACATGAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-367s1c1
Sequence:CCGGCCCAATCTGCAAAGGTCTATTCTCGAGAATAGACCTTTGCAGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1225s1c1
Sequence:CCGGCCGCCTCATCTCTCTCAATATCTCGAGATATTGAGAGAGATGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-448s21c1
Sequence:CCGGCCAATCTGCAAAGGTCTATTCCTCGAGGAATAGACCTTTGCAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1427s21c1
Sequence:GTACCGGGAGGAGACAAAGTGCATATAACTCGAGTTATATGCACTTTGTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1636s21c1
Sequence:CCGGACTACCTACATCGGCCTTAATCTCGAGATTAAGGCCGATGTAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000543
SMPD1 MISSION shRNA Lentiviral Transduction Particles
sphingomyelin phosphodiesterase 1, acid lysosomal
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000543.3-2149s21c1
Sequence:CCGGGGCAAGATCATCCGGTGAAAGCTCGAGCTTTCACCGGATGATCTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1834s21c1
Sequence:CCGGGCCTGGCACAACCTGGTATATCTCGAGATATACCAGGTTGTGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000543.2-2001s1c1
Sequence:CCGGCCCACATTTGGGAAAGTTCTTCTCGAGAAGAACTTTCCCAAATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1054s1c1
Sequence:CCGGCCATGAAAGCATACCTGTCAACTCGAGTTGACAGGTATGCTTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1467s1c1
Sequence:CCGGGCCACACTCATGTGGATGAATCTCGAGATTCATCCACATGAGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-367s1c1
Sequence:CCGGCCCAATCTGCAAAGGTCTATTCTCGAGAATAGACCTTTGCAGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000543.2-1225s1c1
Sequence:CCGGCCGCCTCATCTCTCTCAATATCTCGAGATATTGAGAGAGATGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-448s21c1
Sequence:CCGGCCAATCTGCAAAGGTCTATTCCTCGAGGAATAGACCTTTGCAGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1427s21c1
Sequence:GTACCGGGAGGAGACAAAGTGCATATAACTCGAGTTATATGCACTTTGTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000543.3-1636s21c1
Sequence:CCGGACTACCTACATCGGCCTTAATCTCGAGATTAAGGCCGATGTAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)