EMAIL THIS PAGE TO A FRIEND

SMTN

smoothelin

75 Gene Product Result for
Gene ID:
Human(6525) Summary: This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
Mouse(29856) smoothelin
Rat(289734) smoothelin
chicken(373982) smoothelin
dog(477542) smoothelin
Horse(100058583) smoothelin
chicken(100858894) smoothelin
cow(528013) smoothelin
sheep(101103186) smoothelin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006932 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062871 MISSION® esiRNA esiRNA targeting mouse Smtn (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006932 Rosetta Predictions human pricing
NM_134269 Rosetta Predictions human pricing
NM_134270 Rosetta Predictions human pricing
NM_001013049 Rosetta Predictions rat pricing
NM_013870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071793 predicted 2310
2 SASI_Hs01_00071794 predicted 1596
3 SASI_Hs01_00071795 predicted 2196
4 SASI_Hs01_00071796 predicted 2040
5 SASI_Hs01_00071797 predicted 524
6 SASI_Hs01_00071798 predicted 2073
7 SASI_Hs01_00071800 predicted 2471
8 SASI_Hs01_00071801 predicted 710
9 SASI_Hs01_00071802 predicted 2062
10 SASI_Hs02_00342637 predicted 2193
11 SASI_Hs01_00071799 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143300 predicted 2310
2 SASI_Hs01_00143301 predicted 1587
3 SASI_Hs01_00143302 predicted 2193
4 SASI_Hs01_00143303 predicted 2040
5 SASI_Hs01_00143304 predicted 523
6 SASI_Hs01_00143305 predicted 2073
7 SASI_Hs01_00143307 predicted 2470
8 SASI_Hs01_00143308 predicted 703
9 SASI_Hs01_00143309 predicted 2063
10 SASI_Hs02_00363309 predicted 2201
11 SASI_Hs01_00143306 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166424 predicted 2310
2 SASI_Hs01_00166425 predicted 1592
3 SASI_Hs01_00166426 predicted 2198
4 SASI_Hs01_00166427 predicted 2043
5 SASI_Hs01_00166428 predicted 521
6 SASI_Hs01_00166429 predicted 2073
7 SASI_Hs01_00166431 predicted 2474
8 SASI_Hs01_00166432 predicted 703
9 SASI_Hs01_00166433 predicted 2068
10 SASI_Hs02_00363310 predicted 2193
11 SASI_Hs01_00166430 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200646 predicted 1887
2 SASI_Rn02_00200647 predicted 3069
3 SASI_Rn02_00200648 predicted 473
4 SASI_Rn02_00200649 predicted 1592
5 SASI_Rn02_00200650 predicted 2772
6 SASI_Rn02_00200651 predicted 523
7 SASI_Rn02_00200652 predicted 603
8 SASI_Rn02_00200653 predicted 1973
9 SASI_Rn02_00200654 predicted 2912
10 SASI_Rn02_00200655 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046517 predicted 2361
2 SASI_Mm01_00046518 predicted 1856
3 SASI_Mm02_00322886 predicted 1691
4 SASI_Mm01_00046519 predicted 1557
5 SASI_Mm01_00046520 predicted 1559
6 SASI_Mm01_00046521 predicted 1068
7 SASI_Mm01_00046522 predicted 2100
8 SASI_Mm01_00046523 predicted 450
9 SASI_Mm01_00046524 predicted 1637
10 SASI_Mm01_00046525 predicted 1004
11 SASI_Mm01_00046526 predicted 2246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006932
SMTN MISSION shRNA Bacterial Glycerol Stock
smoothelin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006932.3-2507s21c1
Sequence:CCGGGCGCAAGGCCATGATTGAGAACTCGAGTTCTCAATCATGGCCTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006932.3-513s21c1
Sequence:CCGGTTGCGAAGCGCTGGTGAGTATCTCGAGATACTCACCAGCGCTTCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-481s1c1
Sequence:CCGGCCATGAACGATGTGGAGGAATCTCGAGATTCCTCCACATCGTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-1956s1c1
Sequence:CCGGGCTGAGGAGCTGATGACTATTCTCGAGAATAGTCATCAGCTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-2323s1c1
Sequence:CCGGCCATGATGCAAACCAAGACCTCTCGAGAGGTCTTGGTTTGCATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-2324s1c1
Sequence:CCGGCATGATGCAAACCAAGACCTTCTCGAGAAGGTCTTGGTTTGCATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-1917s1c1
Sequence:CCGGCGAGTGAACAAAGCACCAGAACTCGAGTTCTGGTGCTTTGTTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006932
SMTN MISSION shRNA shRNA Plasmid DNA
smoothelin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006932.3-2507s21c1
Sequence:CCGGGCGCAAGGCCATGATTGAGAACTCGAGTTCTCAATCATGGCCTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006932.3-513s21c1
Sequence:CCGGTTGCGAAGCGCTGGTGAGTATCTCGAGATACTCACCAGCGCTTCGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-481s1c1
Sequence:CCGGCCATGAACGATGTGGAGGAATCTCGAGATTCCTCCACATCGTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-1956s1c1
Sequence:CCGGGCTGAGGAGCTGATGACTATTCTCGAGAATAGTCATCAGCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-2323s1c1
Sequence:CCGGCCATGATGCAAACCAAGACCTCTCGAGAGGTCTTGGTTTGCATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-2324s1c1
Sequence:CCGGCATGATGCAAACCAAGACCTTCTCGAGAAGGTCTTGGTTTGCATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-1917s1c1
Sequence:CCGGCGAGTGAACAAAGCACCAGAACTCGAGTTCTGGTGCTTTGTTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006932
SMTN MISSION shRNA Lentiviral Transduction Particles
smoothelin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006932.3-2507s21c1
Sequence:CCGGGCGCAAGGCCATGATTGAGAACTCGAGTTCTCAATCATGGCCTTGCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006932.3-513s21c1
Sequence:CCGGTTGCGAAGCGCTGGTGAGTATCTCGAGATACTCACCAGCGCTTCGCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-481s1c1
Sequence:CCGGCCATGAACGATGTGGAGGAATCTCGAGATTCCTCCACATCGTTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-1956s1c1
Sequence:CCGGGCTGAGGAGCTGATGACTATTCTCGAGAATAGTCATCAGCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-2323s1c1
Sequence:CCGGCCATGATGCAAACCAAGACCTCTCGAGAGGTCTTGGTTTGCATCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-2324s1c1
Sequence:CCGGCATGATGCAAACCAAGACCTTCTCGAGAAGGTCTTGGTTTGCATCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006932.3-1917s1c1
Sequence:CCGGCGAGTGAACAAAGCACCAGAACTCGAGTTCTGGTGCTTTGTTCACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013870
VALIDATED
SMTN MISSION shRNA Bacterial Glycerol Stock
smoothelin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013870.3-3169s21c1
Sequence:CCGGCAAGAATGTCTAGCCACTCTGCTCGAGCAGAGTGGCTAGACATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-1602s21c1
Sequence:CCGGGCAGTATGAAGACTACGTTTACTCGAGTAAACGTAGTCTTCATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2653s21c1
Sequence:CCGGCGCCAATAGCATCAAGCAGATCTCGAGATCTGCTTGATGCTATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2029s21c1
Sequence:CCGGCCAGACTACGAACTTTGAGGACTCGAGTCCTCAAAGTTCGTAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-2774s1c1
Sequence:CCGGCCGACGCCAGAACTTTGAAATCTCGAGATTTCAAAGTTCTGGCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2827s21c1
Sequence:CCGGCCGACGCCAGAACTTTGAAATCTCGAGATTTCAAAGTTCTGGCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013870.1-1976s1c1
Sequence:CCGGCCAGACTACGAACTTTGAGGACTCGAGTCCTCAAAGTTCGTAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-2600s1c1
Sequence:CCGGCGCCAATAGCATCAAGCAGATCTCGAGATCTGCTTGATGCTATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-1549s1c1
Sequence:CCGGGCAGTATGAAGACTACGTTTACTCGAGTAAACGTAGTCTTCATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013870.1-3015s1c1
Sequence:CCGGGACATGATGATCATGGGCAAACTCGAGTTTGCCCATGATCATCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013870
VALIDATED
SMTN MISSION shRNA shRNA Plasmid DNA
smoothelin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013870.3-3169s21c1
Sequence:CCGGCAAGAATGTCTAGCCACTCTGCTCGAGCAGAGTGGCTAGACATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-1602s21c1
Sequence:CCGGGCAGTATGAAGACTACGTTTACTCGAGTAAACGTAGTCTTCATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2653s21c1
Sequence:CCGGCGCCAATAGCATCAAGCAGATCTCGAGATCTGCTTGATGCTATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2029s21c1
Sequence:CCGGCCAGACTACGAACTTTGAGGACTCGAGTCCTCAAAGTTCGTAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-2774s1c1
Sequence:CCGGCCGACGCCAGAACTTTGAAATCTCGAGATTTCAAAGTTCTGGCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2827s21c1
Sequence:CCGGCCGACGCCAGAACTTTGAAATCTCGAGATTTCAAAGTTCTGGCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013870.1-1976s1c1
Sequence:CCGGCCAGACTACGAACTTTGAGGACTCGAGTCCTCAAAGTTCGTAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-2600s1c1
Sequence:CCGGCGCCAATAGCATCAAGCAGATCTCGAGATCTGCTTGATGCTATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-1549s1c1
Sequence:CCGGGCAGTATGAAGACTACGTTTACTCGAGTAAACGTAGTCTTCATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013870.1-3015s1c1
Sequence:CCGGGACATGATGATCATGGGCAAACTCGAGTTTGCCCATGATCATCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013870
VALIDATED
SMTN MISSION shRNA Lentiviral Transduction Particles
smoothelin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013870.3-3169s21c1
Sequence:CCGGCAAGAATGTCTAGCCACTCTGCTCGAGCAGAGTGGCTAGACATTCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-1602s21c1
Sequence:CCGGGCAGTATGAAGACTACGTTTACTCGAGTAAACGTAGTCTTCATACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2653s21c1
Sequence:CCGGCGCCAATAGCATCAAGCAGATCTCGAGATCTGCTTGATGCTATTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2029s21c1
Sequence:CCGGCCAGACTACGAACTTTGAGGACTCGAGTCCTCAAAGTTCGTAGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-2774s1c1
Sequence:CCGGCCGACGCCAGAACTTTGAAATCTCGAGATTTCAAAGTTCTGGCGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013870.3-2827s21c1
Sequence:CCGGCCGACGCCAGAACTTTGAAATCTCGAGATTTCAAAGTTCTGGCGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013870.1-1976s1c1
Sequence:CCGGCCAGACTACGAACTTTGAGGACTCGAGTCCTCAAAGTTCGTAGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-2600s1c1
Sequence:CCGGCGCCAATAGCATCAAGCAGATCTCGAGATCTGCTTGATGCTATTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013870.1-1549s1c1
Sequence:CCGGGCAGTATGAAGACTACGTTTACTCGAGTAAACGTAGTCTTCATACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013870.1-3015s1c1
Sequence:CCGGGACATGATGATCATGGGCAAACTCGAGTTTGCCCATGATCATCATGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)