EMAIL THIS PAGE TO A FRIEND

SMU1

smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)

43 Gene Product Result for
Synonyms: BWD RP11-54K16.3 SMU-1 fSAP57
UniProtKB ID: Q2TAY7, Q9BU59, Q9HA96, Q9NVD1
Gene ID:
Mouse(74255) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Rat(117541) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
fruit fly(42272) SMU1 ortholog
Horse(100068168) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
domestic cat(101098496) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
dog(474740) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
chicken(427377) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Thale Cress(843707) RNA splicing protein SMU1
Zebrafish(393168) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
cow(540842) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
sheep(101104884) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
domestic guinea pig(100722726) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
naked mole-rat(101720596) smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018225 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018225 siRNAs that have been validated in the lab human pricing
NM_057195 Rosetta Predictions rat pricing
NM_021535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018225 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207143 validated 1220
2 SASI_Hs01_00207141 predicted 1246
3 SASI_Hs02_00351539 predicted 922
4 SASI_Hs01_00207144 predicted 336
5 SASI_Hs01_00207145 predicted 1023
6 SASI_Hs01_00207146 predicted 1360
7 SASI_Hs01_00207147 predicted 875
8 SASI_Hs01_00207148 predicted 477
9 SASI_Hs01_00207149 predicted 844
10 SASI_Hs01_00207150 predicted 1391
11 SASI_Hs01_00207142 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073296 predicted 338
2 SASI_Rn01_00073297 predicted 1203
3 SASI_Rn01_00073298 predicted 1408
4 SASI_Rn01_00073299 predicted 231
5 SASI_Rn01_00073300 predicted 1008
6 SASI_Rn01_00073301 predicted 899
7 SASI_Rn01_00073302 predicted 358
8 SASI_Rn01_00073303 predicted 1313
9 SASI_Rn01_00073304 predicted 1076
10 SASI_Rn01_00073305 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326273 predicted 439
2 SASI_Mm01_00170894 predicted 679
3 SASI_Mm01_00170896 predicted 923
4 SASI_Mm01_00170897 predicted 1455
5 SASI_Mm01_00170898 predicted 669
6 SASI_Mm01_00170899 predicted 284
7 SASI_Mm01_00170900 predicted 418
8 SASI_Mm01_00170901 predicted 1055
9 SASI_Mm01_00170902 predicted 385
10 SASI_Mm01_00170903 predicted 1093
11 SASI_Mm01_00170895 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021535
VALIDATED
SMU1 MISSION shRNA Bacterial Glycerol Stock
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-215s1c1
Sequence:CCGGGCTGATATTAATAGTGGCCATCTCGAGATGGCCACTATTAATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-1641s21c1
Sequence:CCGGGCAGCCCAGGAGCATGTACTTCTCGAGAAGTACATGCTCCTGGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021535.2-1628s1c1
Sequence:CCGGGCAGCCCAGGAGCATGTACTTCTCGAGAAGTACATGCTCCTGGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-1116s1c1
Sequence:CCGGCCTCCTTTGTTAATGAAGCAACTCGAGTTGCTTCATTAACAAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021535.2-374s1c1
Sequence:CCGGCCCATGATTATGTTAAAGCAACTCGAGTTGCTTTAACATAATCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-262s1c1
Sequence:CCGGGTCTCTGAAATTGCCAGACAACTCGAGTTGTCTGGCAATTTCAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-333s21c1
Sequence:CCGGTTGATAGAGCTTCGTGAATTGCTCGAGCAATTCACGAAGCTCTATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021535.4-387s21c1
Sequence:CCGGCCCATGATTATGTTAAAGCAACTCGAGTTGCTTTAACATAATCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-409s21c1
Sequence:CCGGCACAACCAGAGCGCTATATTCCTCGAGGAATATAGCGCTCTGGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-275s21c1
Sequence:CCGGGTCTCTGAAATTGCCAGACAACTCGAGTTGTCTGGCAATTTCAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021535
VALIDATED
SMU1 MISSION shRNA shRNA Plasmid DNA
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-215s1c1
Sequence:CCGGGCTGATATTAATAGTGGCCATCTCGAGATGGCCACTATTAATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-1641s21c1
Sequence:CCGGGCAGCCCAGGAGCATGTACTTCTCGAGAAGTACATGCTCCTGGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021535.2-1628s1c1
Sequence:CCGGGCAGCCCAGGAGCATGTACTTCTCGAGAAGTACATGCTCCTGGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-1116s1c1
Sequence:CCGGCCTCCTTTGTTAATGAAGCAACTCGAGTTGCTTCATTAACAAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021535.2-374s1c1
Sequence:CCGGCCCATGATTATGTTAAAGCAACTCGAGTTGCTTTAACATAATCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-262s1c1
Sequence:CCGGGTCTCTGAAATTGCCAGACAACTCGAGTTGTCTGGCAATTTCAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-333s21c1
Sequence:CCGGTTGATAGAGCTTCGTGAATTGCTCGAGCAATTCACGAAGCTCTATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021535.4-387s21c1
Sequence:CCGGCCCATGATTATGTTAAAGCAACTCGAGTTGCTTTAACATAATCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-409s21c1
Sequence:CCGGCACAACCAGAGCGCTATATTCCTCGAGGAATATAGCGCTCTGGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-275s21c1
Sequence:CCGGGTCTCTGAAATTGCCAGACAACTCGAGTTGTCTGGCAATTTCAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021535
VALIDATED
SMU1 MISSION shRNA Lentiviral Transduction Particles
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-215s1c1
Sequence:CCGGGCTGATATTAATAGTGGCCATCTCGAGATGGCCACTATTAATATCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-1641s21c1
Sequence:CCGGGCAGCCCAGGAGCATGTACTTCTCGAGAAGTACATGCTCCTGGGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021535.2-1628s1c1
Sequence:CCGGGCAGCCCAGGAGCATGTACTTCTCGAGAAGTACATGCTCCTGGGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-1116s1c1
Sequence:CCGGCCTCCTTTGTTAATGAAGCAACTCGAGTTGCTTCATTAACAAAGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021535.2-374s1c1
Sequence:CCGGCCCATGATTATGTTAAAGCAACTCGAGTTGCTTTAACATAATCATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021535.2-262s1c1
Sequence:CCGGGTCTCTGAAATTGCCAGACAACTCGAGTTGTCTGGCAATTTCAGAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-333s21c1
Sequence:CCGGTTGATAGAGCTTCGTGAATTGCTCGAGCAATTCACGAAGCTCTATCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000324315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021535.4-387s21c1
Sequence:CCGGCCCATGATTATGTTAAAGCAACTCGAGTTGCTTTAACATAATCATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-409s21c1
Sequence:CCGGCACAACCAGAGCGCTATATTCCTCGAGGAATATAGCGCTCTGGTTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000324245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021535.4-275s21c1
Sequence:CCGGGTCTCTGAAATTGCCAGACAACTCGAGTTGTCTGGCAATTTCAGAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018225
VALIDATED
SMU1 MISSION shRNA Bacterial Glycerol Stock
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-1087s1c1
Sequence:CCGGCCTTTGTTAACGAAGCAACATCTCGAGATGTTGCTTCGTTAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018225.1-659s1c1
Sequence:CCGGGCATATTAAGTTTGGTCAGAACTCGAGTTCTGACCAAACTTAATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-575s1c1
Sequence:CCGGTCCTGGTATGACCATAGATTTCTCGAGAAATCTATGGTCATACCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018225.1-573s1c1
Sequence:CCGGCCTCCTGGTATGACCATAGATCTCGAGATCTATGGTCATACCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1283s21c1
Sequence:CCGGGCACCGCAGGGACAGATATTACTCGAGTAATATCTGTCCCTGCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-433s21c1
Sequence:CCGGACACAGCCAGAGCGATATATTCTCGAGAATATATCGCTCTGGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-71s1c1
Sequence:CCGGCCGCCTTATTATGCAGTACTTCTCGAGAAGTACTGCATAATAAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1685s21c1
Sequence:CCGGGTACTTAAATGAAGCATATTCCTCGAGGAATATGCTTCATTTAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1157s21c1
Sequence:CCGGCCTTTGTTAACGAAGCAACATCTCGAGATGTTGCTTCGTTAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-358s21c1
Sequence:CCGGTTGATAGAGCTCCGTGAATTGCTCGAGCAATTCACGGAGCTCTATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018225
VALIDATED
SMU1 MISSION shRNA shRNA Plasmid DNA
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-1087s1c1
Sequence:CCGGCCTTTGTTAACGAAGCAACATCTCGAGATGTTGCTTCGTTAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018225.1-659s1c1
Sequence:CCGGGCATATTAAGTTTGGTCAGAACTCGAGTTCTGACCAAACTTAATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-575s1c1
Sequence:CCGGTCCTGGTATGACCATAGATTTCTCGAGAAATCTATGGTCATACCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018225.1-573s1c1
Sequence:CCGGCCTCCTGGTATGACCATAGATCTCGAGATCTATGGTCATACCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1283s21c1
Sequence:CCGGGCACCGCAGGGACAGATATTACTCGAGTAATATCTGTCCCTGCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-433s21c1
Sequence:CCGGACACAGCCAGAGCGATATATTCTCGAGAATATATCGCTCTGGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-71s1c1
Sequence:CCGGCCGCCTTATTATGCAGTACTTCTCGAGAAGTACTGCATAATAAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1685s21c1
Sequence:CCGGGTACTTAAATGAAGCATATTCCTCGAGGAATATGCTTCATTTAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1157s21c1
Sequence:CCGGCCTTTGTTAACGAAGCAACATCTCGAGATGTTGCTTCGTTAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-358s21c1
Sequence:CCGGTTGATAGAGCTCCGTGAATTGCTCGAGCAATTCACGGAGCTCTATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018225
VALIDATED
SMU1 MISSION shRNA Lentiviral Transduction Particles
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-1087s1c1
Sequence:CCGGCCTTTGTTAACGAAGCAACATCTCGAGATGTTGCTTCGTTAACAAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018225.1-659s1c1
Sequence:CCGGGCATATTAAGTTTGGTCAGAACTCGAGTTCTGACCAAACTTAATATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-575s1c1
Sequence:CCGGTCCTGGTATGACCATAGATTTCTCGAGAAATCTATGGTCATACCAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018225.1-573s1c1
Sequence:CCGGCCTCCTGGTATGACCATAGATCTCGAGATCTATGGTCATACCAGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000298570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1283s21c1
Sequence:CCGGGCACCGCAGGGACAGATATTACTCGAGTAATATCTGTCCCTGCGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000293780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-433s21c1
Sequence:CCGGACACAGCCAGAGCGATATATTCTCGAGAATATATCGCTCTGGCTGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018225.1-71s1c1
Sequence:CCGGCCGCCTTATTATGCAGTACTTCTCGAGAAGTACTGCATAATAAGGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000293781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1685s21c1
Sequence:CCGGGTACTTAAATGAAGCATATTCCTCGAGGAATATGCTTCATTTAAGTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000286346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-1157s21c1
Sequence:CCGGCCTTTGTTAACGAAGCAACATCTCGAGATGTTGCTTCGTTAACAAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000293782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018225.2-358s21c1
Sequence:CCGGTTGATAGAGCTCCGTGAATTGCTCGAGCAATTCACGGAGCTCTATCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???