EMAIL THIS PAGE TO A FRIEND

SMURF1

SMAD specific E3 ubiquitin protein ligase 1

107 Gene Product Result for
Gene ID:
Human(57154) Summary: This gene encodes a ubiquitin ligase that is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. This protein plays a key roll in the regulation of cell motility, cell signalling, and cell polarity. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2010]
Mouse(75788) SMAD specific E3 ubiquitin protein ligase 1
Rat(690516) SMAD specific E3 ubiquitin protein ligase 1
cow(513902) SMAD specific E3 ubiquitin protein ligase 1
sheep(101103370) SMAD specific E3 ubiquitin protein ligase 1
domestic guinea pig(100715134) SMAD specific E3 ubiquitin protein ligase 1
naked mole-rat(101723417) SMAD specific E3 ubiquitin protein ligase 1
Zebrafish(321695) SMAD specific E3 ubiquitin protein ligase 1
Horse(100063241) SMAD specific E3 ubiquitin protein ligase 1
domestic cat(101095216) SMAD specific E3 ubiquitin protein ligase 1
dog(608821) SMAD specific E3 ubiquitin protein ligase 1
chicken(416487) SMAD specific E3 ubiquitin protein ligase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020429 Rosetta Predictions human pricing
NM_181349 Rosetta Predictions human pricing
NM_001109598 Rosetta Predictions rat pricing
NM_001038627 Rosetta Predictions mouse pricing
NM_029438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214078 predicted 1703
2 SASI_Hs01_00214079 predicted 1688
3 SASI_Hs01_00214080 predicted 1676
4 SASI_Hs01_00214081 predicted 544
5 SASI_Hs01_00214082 predicted 1542
6 SASI_Hs01_00214084 predicted 687
7 SASI_Hs01_00214085 predicted 506
8 SASI_Hs01_00214086 predicted 1426
9 SASI_Hs01_00214087 predicted 1502
10 SASI_Hs02_00353444 predicted 2499
11 SASI_Hs01_00214083 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228965 predicted 1624
2 SASI_Hs01_00228966 predicted 1613
3 SASI_Hs01_00228967 predicted 1591
4 SASI_Hs01_00228968 predicted 542
5 SASI_Hs01_00228969 predicted 1467
6 SASI_Hs01_00228971 predicted 685
7 SASI_Hs01_00228972 predicted 511
8 SASI_Hs01_00228973 predicted 1348
9 SASI_Hs01_00228974 predicted 1423
10 SASI_Hs02_00370012 predicted 2428
11 SASI_Hs01_00228970 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249947 predicted 1333
2 SASI_Rn02_00249948 predicted 1310
3 SASI_Rn02_00249949 predicted 1093
4 SASI_Rn02_00249950 predicted 1170
5 SASI_Rn02_00249951 predicted 1698
6 SASI_Rn02_00249952 predicted 2130
7 SASI_Rn02_00249953 predicted 388
8 SASI_Rn02_00249954 predicted 412
9 SASI_Rn02_00249955 predicted 1162
10 SASI_Rn02_00249956 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137529 predicted 1581
2 SASI_Mm01_00137530 predicted 1561
3 SASI_Mm01_00137531 predicted 1683
4 SASI_Mm01_00137532 predicted 1584
5 SASI_Mm01_00137533 predicted 1305
6 SASI_Mm01_00137534 predicted 1406
7 SASI_Mm01_00137536 predicted 1946
8 SASI_Mm01_00137537 predicted 1611
9 SASI_Mm01_00137538 predicted 1961
10 SASI_Mm02_00289637 predicted 1581
11 SASI_Mm01_00137535 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170003 predicted 1582
2 SASI_Mm01_00170004 predicted 1565
3 SASI_Mm01_00170005 predicted 1687
4 SASI_Mm01_00170006 predicted 1579
5 SASI_Mm01_00170007 predicted 1308
6 SASI_Mm01_00170008 predicted 1404
7 SASI_Mm01_00170010 predicted 1948
8 SASI_Mm01_00170011 predicted 1616
9 SASI_Mm01_00170012 predicted 1959
10 SASI_Mm02_00335361 predicted 1577
11 SASI_Mm01_00170009 predicted 1331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020429
VALIDATED
SMURF1 MISSION shRNA Bacterial Glycerol Stock
SMAD specific E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1772s1c1
Sequence:CCGGCCACTTGTCTTATTTCCACTTCTCGAGAAGTGGAAATAAGACAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020429.x-4903s1c1
Sequence:CCGGCGATGGTTTGTTTGGTCCTTTCTCGAGAAAGGACCAAACAAACCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1030s1c1
Sequence:CCGGCCGAAGGCTACGAACAAAGAACTCGAGTTCTTTGTTCGTAGCCTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1431s1c1
Sequence:CCGGGCCCAGAGATACGAAAGAGATCTCGAGATCTCTTTCGTATCTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-2099s1c1
Sequence:CCGGCTGGAGGTTTATGAGAGGAATCTCGAGATTCCTCTCATAAACCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020429
VALIDATED
SMURF1 MISSION shRNA shRNA Plasmid DNA
SMAD specific E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1772s1c1
Sequence:CCGGCCACTTGTCTTATTTCCACTTCTCGAGAAGTGGAAATAAGACAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020429.x-4903s1c1
Sequence:CCGGCGATGGTTTGTTTGGTCCTTTCTCGAGAAAGGACCAAACAAACCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1030s1c1
Sequence:CCGGCCGAAGGCTACGAACAAAGAACTCGAGTTCTTTGTTCGTAGCCTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1431s1c1
Sequence:CCGGGCCCAGAGATACGAAAGAGATCTCGAGATCTCTTTCGTATCTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-2099s1c1
Sequence:CCGGCTGGAGGTTTATGAGAGGAATCTCGAGATTCCTCTCATAAACCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020429
VALIDATED
SMURF1 MISSION shRNA Lentiviral Transduction Particles
SMAD specific E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1772s1c1
Sequence:CCGGCCACTTGTCTTATTTCCACTTCTCGAGAAGTGGAAATAAGACAAGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020429.x-4903s1c1
Sequence:CCGGCGATGGTTTGTTTGGTCCTTTCTCGAGAAAGGACCAAACAAACCATCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1030s1c1
Sequence:CCGGCCGAAGGCTACGAACAAAGAACTCGAGTTCTTTGTTCGTAGCCTTCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-1431s1c1
Sequence:CCGGGCCCAGAGATACGAAAGAGATCTCGAGATCTCTTTCGTATCTCTGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020429.x-2099s1c1
Sequence:CCGGCTGGAGGTTTATGAGAGGAATCTCGAGATTCCTCTCATAAACCTCCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029438
SMURF1 MISSION shRNA Bacterial Glycerol Stock
SMAD specific E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-1614s1c1
Sequence:CCGGCCAGTATTCCACGGACAATATCTCGAGATATTGTCCGTGGAATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-2127s1c1
Sequence:CCGGGCTGGATAAGATAGACCTGAACTCGAGTTCAGGTCTATCTTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-1581s1c1
Sequence:CCGGCCATGAAATGTTGAACCCGTACTCGAGTACGGGTTCAACATTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-493s1c1
Sequence:CCGGCAGCACTATGACCTGTATGTTCTCGAGAACATACAGGTCATAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-367s1c1
Sequence:CCGGGCCAAGAACCTTGCAAAGAAACTCGAGTTTCTTTGCAAGGTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029438
SMURF1 MISSION shRNA shRNA Plasmid DNA
SMAD specific E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-1614s1c1
Sequence:CCGGCCAGTATTCCACGGACAATATCTCGAGATATTGTCCGTGGAATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-2127s1c1
Sequence:CCGGGCTGGATAAGATAGACCTGAACTCGAGTTCAGGTCTATCTTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-1581s1c1
Sequence:CCGGCCATGAAATGTTGAACCCGTACTCGAGTACGGGTTCAACATTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-493s1c1
Sequence:CCGGCAGCACTATGACCTGTATGTTCTCGAGAACATACAGGTCATAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-367s1c1
Sequence:CCGGGCCAAGAACCTTGCAAAGAAACTCGAGTTTCTTTGCAAGGTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029438
SMURF1 MISSION shRNA Lentiviral Transduction Particles
SMAD specific E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-1614s1c1
Sequence:CCGGCCAGTATTCCACGGACAATATCTCGAGATATTGTCCGTGGAATACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-2127s1c1
Sequence:CCGGGCTGGATAAGATAGACCTGAACTCGAGTTCAGGTCTATCTTATCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-1581s1c1
Sequence:CCGGCCATGAAATGTTGAACCCGTACTCGAGTACGGGTTCAACATTTCATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-493s1c1
Sequence:CCGGCAGCACTATGACCTGTATGTTCTCGAGAACATACAGGTCATAGTGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000040574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029438.2-367s1c1
Sequence:CCGGGCCAAGAACCTTGCAAAGAAACTCGAGTTTCTTTGCAAGGTTCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???