EMAIL THIS PAGE TO A FRIEND

SMYD5

SMYD family member 5

133 Gene Product Result for
Synonyms: NN8-4AG RAI15 RRG1 ZMYND23
UniProtKB ID: Q6GMV2, D6W5H3, Q13558
Gene ID:
Mouse(232187) SET and MYND domain containing 5
Rat(312503) SMYD family member 5
Zebrafish(447875) SMYD family member 5
chicken(422951) SMYD family member 5
dog(475798) SMYD family member 5
Horse(100059113) SMYD family member 5
domestic cat(101080274) SMYD family member 5
Domestic Rabbit(100355605) SMYD family member 5
naked mole-rat(101707584) SMYD family member 5
domestic guinea pig(100718307) SMYD family member 5
cow(509313) SMYD family member 5
sheep(101104141) SMYD family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006062 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136481 MISSION® esiRNA esiRNA human SMYD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006062 Rosetta Predictions human pricing
NM_001107870 Rosetta Predictions rat pricing
NM_144918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103147 predicted 499
2 SASI_Hs01_00103148 predicted 905
3 SASI_Hs01_00103149 predicted 575
4 SASI_Hs02_00340821 predicted 288
5 SASI_Hs01_00103150 predicted 831
6 SASI_Hs02_00340822 predicted 1488
7 SASI_Hs01_00103152 predicted 721
8 SASI_Hs01_00103153 predicted 746
9 SASI_Hs01_00103154 predicted 517
10 SASI_Hs01_00103155 predicted 547
11 SASI_Hs01_00103151 predicted 840
12 SASI_Hs01_00103156 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233095 predicted 1047
2 SASI_Rn02_00233096 predicted 859
3 SASI_Rn02_00233097 predicted 907
4 SASI_Rn02_00233098 predicted 1728
5 SASI_Rn02_00233099 predicted 1625
6 SASI_Rn02_00233100 predicted 1709
7 SASI_Rn02_00233101 predicted 1107
8 SASI_Rn02_00233102 predicted 734
9 SASI_Rn02_00233103 predicted 1119
10 SASI_Rn02_00233104 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340399 predicted 330
2 SASI_Mm02_00340400 predicted 1049
3 SASI_Mm02_00340401 predicted 909
4 SASI_Mm01_00182904 predicted 538
5 SASI_Mm02_00340402 predicted 641
6 SASI_Mm01_00182907 predicted 702
7 SASI_Mm02_00340403 predicted 1112
8 SASI_Mm02_00340404 predicted 856
9 SASI_Mm02_00340405 predicted 740
10 SASI_Mm02_00340406 predicted 632
11 SASI_Mm01_00182901 predicted 602
12 SASI_Mm01_00182902 predicted 1539
13 SASI_Mm01_00182903 predicted 500
14 SASI_Mm01_00182905 predicted 675
15 SASI_Mm01_00182906 predicted 744
16 SASI_Mm01_00182908 predicted 491
17 SASI_Mm01_00182909 predicted 544
18 SASI_Mm01_00182910 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144918
VALIDATED
SMYD5 MISSION shRNA Bacterial Glycerol Stock
SMYD family member 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1266s21c1
Sequence:CCGGATGACCGACGTGTGATGTTATCTCGAGATAACATCACACGTCGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144918.1-1548s1c1
Sequence:CCGGGAATCAAGTTTCAGGTCTCATCTCGAGATGAGACCTGAAACTTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-91s21c1
Sequence:CCGGGTTCCGTGGAAGTCCGTTATGCTCGAGCATAACGGACTTCCACGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1642s21c1
Sequence:CCGGCTCCTATTGACTGGCTATTAACTCGAGTTAATAGCCAGTCAATAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144918.1-1045s1c1
Sequence:CCGGCGAGGAAATATGTATCAGCTACTCGAGTAGCTGATACATATTTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1031s21c1
Sequence:CCGGTACTGCCCTGGAGGATATTAACTCGAGTTAATATCCTCCAGGGCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-509s21c1
Sequence:CCGGTCCTGAGACTGCGAGTATAATCTCGAGATTATACTCGCAGTCTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144918.1-848s1c1
Sequence:CCGGGAACAACTAGACACCTTCATTCTCGAGAATGAAGGTGTCTAGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144918
VALIDATED
SMYD5 MISSION shRNA shRNA Plasmid DNA
SMYD family member 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1266s21c1
Sequence:CCGGATGACCGACGTGTGATGTTATCTCGAGATAACATCACACGTCGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144918.1-1548s1c1
Sequence:CCGGGAATCAAGTTTCAGGTCTCATCTCGAGATGAGACCTGAAACTTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-91s21c1
Sequence:CCGGGTTCCGTGGAAGTCCGTTATGCTCGAGCATAACGGACTTCCACGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1642s21c1
Sequence:CCGGCTCCTATTGACTGGCTATTAACTCGAGTTAATAGCCAGTCAATAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144918.1-1045s1c1
Sequence:CCGGCGAGGAAATATGTATCAGCTACTCGAGTAGCTGATACATATTTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1031s21c1
Sequence:CCGGTACTGCCCTGGAGGATATTAACTCGAGTTAATATCCTCCAGGGCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-509s21c1
Sequence:CCGGTCCTGAGACTGCGAGTATAATCTCGAGATTATACTCGCAGTCTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144918.1-848s1c1
Sequence:CCGGGAACAACTAGACACCTTCATTCTCGAGAATGAAGGTGTCTAGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144918
VALIDATED
SMYD5 MISSION shRNA Lentiviral Transduction Particles
SMYD family member 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1266s21c1
Sequence:CCGGATGACCGACGTGTGATGTTATCTCGAGATAACATCACACGTCGGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144918.1-1548s1c1
Sequence:CCGGGAATCAAGTTTCAGGTCTCATCTCGAGATGAGACCTGAAACTTGATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-91s21c1
Sequence:CCGGGTTCCGTGGAAGTCCGTTATGCTCGAGCATAACGGACTTCCACGGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1642s21c1
Sequence:CCGGCTCCTATTGACTGGCTATTAACTCGAGTTAATAGCCAGTCAATAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144918.1-1045s1c1
Sequence:CCGGCGAGGAAATATGTATCAGCTACTCGAGTAGCTGATACATATTTCCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-1031s21c1
Sequence:CCGGTACTGCCCTGGAGGATATTAACTCGAGTTAATATCCTCCAGGGCAGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144918.2-509s21c1
Sequence:CCGGTCCTGAGACTGCGAGTATAATCTCGAGATTATACTCGCAGTCTCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144918.1-848s1c1
Sequence:CCGGGAACAACTAGACACCTTCATTCTCGAGAATGAAGGTGTCTAGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006062
VALIDATED
SMYD5 MISSION shRNA Bacterial Glycerol Stock
SMYD family member 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-1164s1c1
Sequence:CCGGGAACCCAATGTGACCTCAGAACTCGAGTTCTGAGGTCACATTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006062.1-620s1c1
Sequence:CCGGCCATAAACTTCTGGGAGACAACTCGAGTTGTCTCCCAGAAGTTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-597s1c1
Sequence:CCGGGCCAATGAAGAGGAGGAAATTCTCGAGAATTTCCTCCTCTTCATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006062.1-2299s1c1
Sequence:CCGGGCTATGGGAATTACAACCCATCTCGAGATGGGTTGTAATTCCCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-806s1c1
Sequence:CCGGCTGTGACACTCTGGAGTTGAACTCGAGTTCAACTCCAGAGTGTCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-494s1c1
Sequence:CCGGGACTGCAAGCATCATGTTGATCTCGAGATCAACATGATGCTTGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006062
VALIDATED
SMYD5 MISSION shRNA shRNA Plasmid DNA
SMYD family member 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-1164s1c1
Sequence:CCGGGAACCCAATGTGACCTCAGAACTCGAGTTCTGAGGTCACATTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006062.1-620s1c1
Sequence:CCGGCCATAAACTTCTGGGAGACAACTCGAGTTGTCTCCCAGAAGTTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-597s1c1
Sequence:CCGGGCCAATGAAGAGGAGGAAATTCTCGAGAATTTCCTCCTCTTCATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006062.1-2299s1c1
Sequence:CCGGGCTATGGGAATTACAACCCATCTCGAGATGGGTTGTAATTCCCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-806s1c1
Sequence:CCGGCTGTGACACTCTGGAGTTGAACTCGAGTTCAACTCCAGAGTGTCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-494s1c1
Sequence:CCGGGACTGCAAGCATCATGTTGATCTCGAGATCAACATGATGCTTGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006062
VALIDATED
SMYD5 MISSION shRNA Lentiviral Transduction Particles
SMYD family member 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-1164s1c1
Sequence:CCGGGAACCCAATGTGACCTCAGAACTCGAGTTCTGAGGTCACATTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006062.1-620s1c1
Sequence:CCGGCCATAAACTTCTGGGAGACAACTCGAGTTGTCTCCCAGAAGTTTATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-597s1c1
Sequence:CCGGGCCAATGAAGAGGAGGAAATTCTCGAGAATTTCCTCCTCTTCATTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006062.1-2299s1c1
Sequence:CCGGGCTATGGGAATTACAACCCATCTCGAGATGGGTTGTAATTCCCATAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-806s1c1
Sequence:CCGGCTGTGACACTCTGGAGTTGAACTCGAGTTCAACTCCAGAGTGTCACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006062.1-494s1c1
Sequence:CCGGGACTGCAAGCATCATGTTGATCTCGAGATCAACATGATGCTTGCAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)