EMAIL THIS PAGE TO A FRIEND

SNAI2

snail family zinc finger 2

125 Gene Product Result for
Synonyms: SLUG SLUGH1 SNAIL2 WS2D
UniProtKB ID: O43623, B2R6P6, Q53FC1
Gene ID:
Human(6591) Summary: This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]
Mouse(20583) snail homolog 2 (Drosophila)
Rat(25554) snail family zinc finger 2
Zebrafish(494038) snail homolog 2 (Drosophila)
chicken(432368) snail homolog 2 (Drosophila)
dog(486940) snail homolog 2 (Drosophila)
domestic cat(101090987) snail homolog 2 (Drosophila)
naked mole-rat(101717470) snail family zinc finger 2
domestic guinea pig(100724275) snail family zinc finger 2
cow(520631) snail homolog 2 (Drosophila)
sheep(100127220) snail homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3957 Anti-Slug (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
PRS3959 Anti-Slug (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1305973 ANTI-SLUG (N-TERM K9) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
ABE993 Anti-SLUG (SNAI2) Anti-SLUG (SNAI2), Cat. No. ABE993, is a highly specific rabbit polyclonal antibody that targets Zinc finger protein SNAI2 and has been tested for use in Immunohistochemistry (Paraffin) and Western Blotting. human, human
immunohistochemistry, western blot pricing
SAB1406453 Anti-SNAI2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412527 ANTI-SNAI2 antibody produced in mouse clone 6A7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412528 ANTI-SNAI2 antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AV33302 Anti-SNAI2 antibody produced in rabbit affinity isolated antibody human, rabbit, guinea pig, rat, sheep, dog, horse, bovine
immunohistochemistry, western blot pricing
WH0006591M5 Monoclonal Anti-SNAI2 antibody produced in mouse clone 3C12, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB1404377 Monoclonal Anti-SNAI2 antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003068 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003068 Rosetta Predictions human pricing
NM_013035 Rosetta Predictions rat pricing
NM_011415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159363 predicted 822
2 SASI_Hs01_00159364 predicted 830
3 SASI_Hs02_00334984 predicted 228
4 SASI_Hs01_00159365 predicted 555
5 SASI_Hs01_00159366 predicted 251
6 SASI_Hs01_00159367 predicted 609
7 SASI_Hs01_00159368 predicted 699
8 SASI_Hs01_00159369 predicted 223
9 SASI_Hs01_00159370 predicted 379
10 SASI_Hs01_00159371 predicted 754
11 SASI_Hs01_00159372 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108597 predicted 288
2 SASI_Rn01_00108598 predicted 442
3 SASI_Rn01_00108600 predicted 221
4 SASI_Rn01_00108601 predicted 292
5 SASI_Rn01_00108602 predicted 378
6 SASI_Rn01_00108603 predicted 364
7 SASI_Rn01_00108604 predicted 414
8 SASI_Rn01_00108605 predicted 394
9 SASI_Rn01_00108606 predicted 403
10 SASI_Rn02_00260740 predicted 326
11 SASI_Rn01_00108599 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143833 predicted 404
2 SASI_Mm01_00143834 predicted 564
3 SASI_Mm01_00143835 predicted 263
4 SASI_Mm01_00143836 predicted 291
5 SASI_Mm01_00143837 predicted 277
6 SASI_Mm01_00143838 predicted 562
7 SASI_Mm01_00143839 predicted 337
8 SASI_Mm01_00143840 predicted 410
9 SASI_Mm01_00143841 predicted 710
10 SASI_Mm01_00143842 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011415
VALIDATED
SNAI2 MISSION shRNA Bacterial Glycerol Stock
snail family zinc finger 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-265s21c1
Sequence:CCGGGGGAGCATACAGCCCTATTACCTCGAGGTAATAGGGCTGTATGCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-1185s21c1
Sequence:CCGGTTCGTTCTATGTGAAGTTTAACTCGAGTTAAACTTCACATAGAACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-511s21c1
Sequence:CCGGTTTATGCAATAAGACCTATTCCTCGAGGAATAGGTCTTATTGCATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-814s21c1
Sequence:CCGGGCAGACCCACTCTGATGTAAACTCGAGTTTACATCAGAGTGGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-212s21c1
Sequence:CCGGCTCTATGAAAGTTACCCTATACTCGAGTATAGGGTAACTTTCATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011415.2-205s1c1
Sequence:CCGGCCCATATCTCTATGAAAGTTACTCGAGTAACTTTCATAGAGATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-814s1c1
Sequence:CCGGGCAGACCCACTCTGATGTAAACTCGAGTTTACATCAGAGTGGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-276s1c1
Sequence:CCGGGCCCTATTACTGTATGGACATCTCGAGATGTCCATACAGTAATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011415.2-225s1c1
Sequence:CCGGACCCTATACCTGTCATACCAACTCGAGTTGGTATGACAGGTATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-1815s1c1
Sequence:CCGGCCTGTCTTAATGACTTGTGTACTCGAGTACACAAGTCATTAAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011415
VALIDATED
SNAI2 MISSION shRNA shRNA Plasmid DNA
snail family zinc finger 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-265s21c1
Sequence:CCGGGGGAGCATACAGCCCTATTACCTCGAGGTAATAGGGCTGTATGCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-1185s21c1
Sequence:CCGGTTCGTTCTATGTGAAGTTTAACTCGAGTTAAACTTCACATAGAACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-511s21c1
Sequence:CCGGTTTATGCAATAAGACCTATTCCTCGAGGAATAGGTCTTATTGCATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-814s21c1
Sequence:CCGGGCAGACCCACTCTGATGTAAACTCGAGTTTACATCAGAGTGGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-212s21c1
Sequence:CCGGCTCTATGAAAGTTACCCTATACTCGAGTATAGGGTAACTTTCATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011415.2-205s1c1
Sequence:CCGGCCCATATCTCTATGAAAGTTACTCGAGTAACTTTCATAGAGATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-814s1c1
Sequence:CCGGGCAGACCCACTCTGATGTAAACTCGAGTTTACATCAGAGTGGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-276s1c1
Sequence:CCGGGCCCTATTACTGTATGGACATCTCGAGATGTCCATACAGTAATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011415.2-225s1c1
Sequence:CCGGACCCTATACCTGTCATACCAACTCGAGTTGGTATGACAGGTATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-1815s1c1
Sequence:CCGGCCTGTCTTAATGACTTGTGTACTCGAGTACACAAGTCATTAAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011415
VALIDATED
SNAI2 MISSION shRNA Lentiviral Transduction Particles
snail family zinc finger 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-265s21c1
Sequence:CCGGGGGAGCATACAGCCCTATTACCTCGAGGTAATAGGGCTGTATGCTCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-1185s21c1
Sequence:CCGGTTCGTTCTATGTGAAGTTTAACTCGAGTTAAACTTCACATAGAACGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-511s21c1
Sequence:CCGGTTTATGCAATAAGACCTATTCCTCGAGGAATAGGTCTTATTGCATAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-814s21c1
Sequence:CCGGGCAGACCCACTCTGATGTAAACTCGAGTTTACATCAGAGTGGGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011415.2-212s21c1
Sequence:CCGGCTCTATGAAAGTTACCCTATACTCGAGTATAGGGTAACTTTCATAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011415.2-205s1c1
Sequence:CCGGCCCATATCTCTATGAAAGTTACTCGAGTAACTTTCATAGAGATATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-814s1c1
Sequence:CCGGGCAGACCCACTCTGATGTAAACTCGAGTTTACATCAGAGTGGGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-276s1c1
Sequence:CCGGGCCCTATTACTGTATGGACATCTCGAGATGTCCATACAGTAATAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011415.2-225s1c1
Sequence:CCGGACCCTATACCTGTCATACCAACTCGAGTTGGTATGACAGGTATAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011415.2-1815s1c1
Sequence:CCGGCCTGTCTTAATGACTTGTGTACTCGAGTACACAAGTCATTAAGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003068
VALIDATED
SNAI2 MISSION shRNA Bacterial Glycerol Stock
snail family zinc finger 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-1016s21c1
Sequence:CCGGCCGAAGCCAAATGACAAATAACTCGAGTTATTTGTCATTTGGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003068.3-557s21c1
Sequence:CCGGTTTATGCAATAAGACCTATTCCTCGAGGAATAGGTCTTATTGCATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-679s21c1
Sequence:CCGGGCGCCCTGAAGATGCATATTCCTCGAGGAATATGCATCTTCAGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003068.3-1315s1c1
Sequence:CCGGGCCAAATCATTTCAACTGAAACTCGAGTTTCAGTTGAAATGATTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003068.3-865s1c1
Sequence:CCGGCCCATTCTGATGTAAAGAAATCTCGAGATTTCTTTACATCAGAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-810s1c1
Sequence:CCGGCCTCACTGCAACAGAGCATTTCTCGAGAAATGCTCTGTTGCAGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-641s1c1
Sequence:CCGGCAGCTGTAAATACTGTGACAACTCGAGTTGTCACAGTATTTACAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-254s1c1
Sequence:CCGGCCCGTATCTCTATGAGAGTTACTCGAGTAACTCTCATAGAGATACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-970s21c1
Sequence:CCGGGAGTGACGCAATCAATGTTTACTCGAGTAAACATTGATTGCGTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003068.3-393s21c1
Sequence:CCGGTCCGGATACTCCTCATCTTTGCTCGAGCAAAGATGAGGAGTATCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003068
VALIDATED
SNAI2 MISSION shRNA shRNA Plasmid DNA
snail family zinc finger 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-1016s21c1
Sequence:CCGGCCGAAGCCAAATGACAAATAACTCGAGTTATTTGTCATTTGGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003068.3-557s21c1
Sequence:CCGGTTTATGCAATAAGACCTATTCCTCGAGGAATAGGTCTTATTGCATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-679s21c1
Sequence:CCGGGCGCCCTGAAGATGCATATTCCTCGAGGAATATGCATCTTCAGGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003068.3-1315s1c1
Sequence:CCGGGCCAAATCATTTCAACTGAAACTCGAGTTTCAGTTGAAATGATTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003068.3-865s1c1
Sequence:CCGGCCCATTCTGATGTAAAGAAATCTCGAGATTTCTTTACATCAGAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-810s1c1
Sequence:CCGGCCTCACTGCAACAGAGCATTTCTCGAGAAATGCTCTGTTGCAGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-641s1c1
Sequence:CCGGCAGCTGTAAATACTGTGACAACTCGAGTTGTCACAGTATTTACAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-254s1c1
Sequence:CCGGCCCGTATCTCTATGAGAGTTACTCGAGTAACTCTCATAGAGATACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-970s21c1
Sequence:CCGGGAGTGACGCAATCAATGTTTACTCGAGTAAACATTGATTGCGTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003068.3-393s21c1
Sequence:CCGGTCCGGATACTCCTCATCTTTGCTCGAGCAAAGATGAGGAGTATCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003068
VALIDATED
SNAI2 MISSION shRNA Lentiviral Transduction Particles
snail family zinc finger 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-1016s21c1
Sequence:CCGGCCGAAGCCAAATGACAAATAACTCGAGTTATTTGTCATTTGGCTTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003068.3-557s21c1
Sequence:CCGGTTTATGCAATAAGACCTATTCCTCGAGGAATAGGTCTTATTGCATAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-679s21c1
Sequence:CCGGGCGCCCTGAAGATGCATATTCCTCGAGGAATATGCATCTTCAGGGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003068.3-1315s1c1
Sequence:CCGGGCCAAATCATTTCAACTGAAACTCGAGTTTCAGTTGAAATGATTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003068.3-865s1c1
Sequence:CCGGCCCATTCTGATGTAAAGAAATCTCGAGATTTCTTTACATCAGAATGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-810s1c1
Sequence:CCGGCCTCACTGCAACAGAGCATTTCTCGAGAAATGCTCTGTTGCAGTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-641s1c1
Sequence:CCGGCAGCTGTAAATACTGTGACAACTCGAGTTGTCACAGTATTTACAGCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003068.3-254s1c1
Sequence:CCGGCCCGTATCTCTATGAGAGTTACTCGAGTAACTCTCATAGAGATACGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003068.3-970s21c1
Sequence:CCGGGAGTGACGCAATCAATGTTTACTCGAGTAAACATTGATTGCGTCACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003068.3-393s21c1
Sequence:CCGGTCCGGATACTCCTCATCTTTGCTCGAGCAAAGATGAGGAGTATCCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)