EMAIL THIS PAGE TO A FRIEND

SNAI3

snail family zinc finger 3

43 Gene Product Result for
Synonyms: SMUC SNAIL3 ZNF293 Zfp293
UniProtKB ID: Q3KNW1, Q86SU5
Gene ID:
Human(333929) Summary: SNAI3 is a member of the SNAIL gene family, named for the Drosophila snail gene, which plays roles in mesodermal formation during embryogenesis (Katoh and Katoh, 2003 [PubMed 12579345]
Mouse(30927) snail homolog 3 (Drosophila)
Rat(307919) snail family zinc finger 3
cow(526694) snail homolog 3 (Drosophila)
sheep(101107302) snail homolog 3 (Drosophila)
sheep(100127223) snail homolog 3 (Drosophila)
domestic guinea pig(100734010) snail family zinc finger 3
naked mole-rat(101709935) snail family zinc finger 3
Zebrafish(567724) snail homolog 3
domestic cat(101097691) snail homolog 3 (Drosophila)
dog(608945) snail homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370995 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004851 MISSION® esiRNA esiRNA targeting mouse Snai3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178310 Rosetta Predictions human pricing
NM_001107439 Rosetta Predictions rat pricing
NM_013914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083970 predicted 768
2 SASI_Hs01_00083971 predicted 515
3 SASI_Hs02_00369629 predicted 604
4 SASI_Hs02_00369630 predicted 1320
5 SASI_Hs01_00083973 predicted 1348
6 SASI_Hs01_00083974 predicted 831
7 SASI_Hs01_00083976 predicted 872
8 SASI_Hs01_00083977 predicted 613
9 SASI_Hs01_00083979 predicted 1063
10 SASI_Hs02_00369631 predicted 325
11 SASI_Hs01_00083972 predicted 1326
12 SASI_Hs01_00083975 predicted 386
13 SASI_Hs01_00083978 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228835 predicted 1149
2 SASI_Rn02_00228836 predicted 942
3 SASI_Rn02_00228837 predicted 1318
4 SASI_Rn02_00228838 predicted 1278
5 SASI_Rn02_00228839 predicted 1324
6 SASI_Rn02_00228840 predicted 756
7 SASI_Rn02_00228841 predicted 600
8 SASI_Rn02_00228842 predicted 612
9 SASI_Rn02_00228843 predicted 1001
10 SASI_Rn02_00228844 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024793 predicted 763
2 SASI_Mm01_00024794 predicted 1176
3 SASI_Mm01_00024795 predicted 1286
4 SASI_Mm01_00024796 predicted 611
5 SASI_Mm01_00024797 predicted 1075
6 SASI_Mm01_00024798 predicted 1295
7 SASI_Mm01_00024799 predicted 1020
8 SASI_Mm01_00024800 predicted 1148
9 SASI_Mm02_00323010 predicted 738
10 SASI_Mm01_00024801 predicted 1274
11 SASI_Mm01_00024792 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013914
SNAI3 MISSION shRNA Bacterial Glycerol Stock
snail family zinc finger 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-297s1c1
Sequence:CCGGGCCGAATCACAGAGAAACTCTCTCGAGAGAGTTTCTCTGTGATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-380s1c1
Sequence:CCGGCCAGTGTGACTCTTAAAGACACTCGAGTGTCTTTAAGAGTCACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013914.2-1372s1c1
Sequence:CCGGCCTTATGTACACATGCGTGTACTCGAGTACACGCATGTGTACATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-837s1c1
Sequence:CCGGTCACGTTGGTACCAAGAAGTACTCGAGTACTTCTTGGTACCAACGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-462s1c1
Sequence:CCGGCGGAGCTCTAAATGAACATCTCTCGAGAGATGTTCATTTAGAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013914
SNAI3 MISSION shRNA shRNA Plasmid DNA
snail family zinc finger 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-297s1c1
Sequence:CCGGGCCGAATCACAGAGAAACTCTCTCGAGAGAGTTTCTCTGTGATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-380s1c1
Sequence:CCGGCCAGTGTGACTCTTAAAGACACTCGAGTGTCTTTAAGAGTCACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013914.2-1372s1c1
Sequence:CCGGCCTTATGTACACATGCGTGTACTCGAGTACACGCATGTGTACATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-837s1c1
Sequence:CCGGTCACGTTGGTACCAAGAAGTACTCGAGTACTTCTTGGTACCAACGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-462s1c1
Sequence:CCGGCGGAGCTCTAAATGAACATCTCTCGAGAGATGTTCATTTAGAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013914
SNAI3 MISSION shRNA Lentiviral Transduction Particles
snail family zinc finger 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-297s1c1
Sequence:CCGGGCCGAATCACAGAGAAACTCTCTCGAGAGAGTTTCTCTGTGATTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-380s1c1
Sequence:CCGGCCAGTGTGACTCTTAAAGACACTCGAGTGTCTTTAAGAGTCACACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013914.2-1372s1c1
Sequence:CCGGCCTTATGTACACATGCGTGTACTCGAGTACACGCATGTGTACATAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-837s1c1
Sequence:CCGGTCACGTTGGTACCAAGAAGTACTCGAGTACTTCTTGGTACCAACGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013914.2-462s1c1
Sequence:CCGGCGGAGCTCTAAATGAACATCTCTCGAGAGATGTTCATTTAGAGCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370995
SNAI3 MISSION shRNA Bacterial Glycerol Stock
snail family zinc finger 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000033301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-855s1c1
Sequence:CCGGGCAAACGCACTCAGACGCCAACTCGAGTTGGCGTCTGAGTGCGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-627s1c1
Sequence:CCGGGCGTGTCTTCACCTGCAAGTACTCGAGTACTTGCAGGTGAAGACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-405s1c1
Sequence:CCGGAGACAGCCTGAACCACCTCAACTCGAGTTGAGGTGGTTCAGGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-151s1c1
Sequence:CCGGGAGACGCAGAGAGAAATCAATCTCGAGATTGATTTCTCTCTGCGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370995
SNAI3 MISSION shRNA shRNA Plasmid DNA
snail family zinc finger 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000033301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-855s1c1
Sequence:CCGGGCAAACGCACTCAGACGCCAACTCGAGTTGGCGTCTGAGTGCGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-627s1c1
Sequence:CCGGGCGTGTCTTCACCTGCAAGTACTCGAGTACTTGCAGGTGAAGACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-405s1c1
Sequence:CCGGAGACAGCCTGAACCACCTCAACTCGAGTTGAGGTGGTTCAGGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-151s1c1
Sequence:CCGGGAGACGCAGAGAGAAATCAATCTCGAGATTGATTTCTCTCTGCGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370995
SNAI3 MISSION shRNA Lentiviral Transduction Particles
snail family zinc finger 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000033301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-855s1c1
Sequence:CCGGGCAAACGCACTCAGACGCCAACTCGAGTTGGCGTCTGAGTGCGTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-627s1c1
Sequence:CCGGGCGTGTCTTCACCTGCAAGTACTCGAGTACTTGCAGGTGAAGACACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-405s1c1
Sequence:CCGGAGACAGCCTGAACCACCTCAACTCGAGTTGAGGTGGTTCAGGCTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370995.2-151s1c1
Sequence:CCGGGAGACGCAGAGAGAAATCAATCTCGAGATTGATTTCTCTCTGCGTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)