EMAIL THIS PAGE TO A FRIEND

SNAPC4

small nuclear RNA activating complex, polypeptide 4, 190kDa

53 Gene Product Result for
Synonyms: PTFalpha SNAP190
UniProtKB ID: Q5SXM2, Q9Y6P7
Gene ID:
Mouse(227644) small nuclear RNA activating complex, polypeptide 4
Rat(362088) small nuclear RNA activating complex, polypeptide 4
Zebrafish(561241) small nuclear RNA activating complex, polypeptide 4
chicken(417133) small nuclear RNA activating complex, polypeptide 4, 190kDa
domestic cat(101093404) small nuclear RNA activating complex, polypeptide 4, 190kDa
dog(491251) small nuclear RNA activating complex, polypeptide 4, 190kDa
naked mole-rat(101698609) small nuclear RNA activating complex, polypeptide 4, 190kDa
domestic guinea pig(100723744) small nuclear RNA activating complex, polypeptide 4, 190kDa
cow(512086) small nuclear RNA activating complex, polypeptide 4, 190kDa
sheep(101116303) small nuclear RNA activating complex, polypeptide 4, 190kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA046627 Anti-SNAPC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA073243 Anti-SNAPC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0006621M4 Monoclonal Anti-SNAPC4 antibody produced in mouse clone 4G5, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
SAB1404388 Monoclonal Anti-SNAPC4 antibody produced in mouse clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409693 Monoclonal Anti-SNAPC4 antibody produced in mouse clone 1G2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409694 Monoclonal Anti-SNAPC4 antibody produced in mouse clone 3E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409695 Monoclonal Anti-SNAPC4 antibody produced in mouse clone 2H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409696 Monoclonal Anti-SNAPC4 antibody produced in mouse clone 3F10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409697 Monoclonal Anti-SNAPC4 antibody produced in mouse clone 3F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409698 Monoclonal Anti-SNAPC4 antibody produced in mouse clone X1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003086 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108011 MISSION® esiRNA esiRNA human SNAPC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003086 Rosetta Predictions human pricing
NM_001108574 Rosetta Predictions rat pricing
NM_172339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335013 predicted 791
2 SASI_Hs01_00018015 predicted 1132
3 SASI_Hs02_00335014 predicted 2414
4 SASI_Hs02_00335015 predicted 2386
5 SASI_Hs02_00335016 predicted 1122
6 SASI_Hs01_00018018 predicted 1329
7 SASI_Hs02_00335017 predicted 2559
8 SASI_Hs02_00335018 predicted 488
9 SASI_Hs02_00335019 predicted 4344
10 SASI_Hs02_00335020 predicted 4182
11 SASI_Hs01_00018014 predicted 627
12 SASI_Hs01_00018016 predicted 1165
13 SASI_Hs01_00018017 predicted 1244
14 SASI_Hs01_00018019 predicted 436
15 SASI_Hs01_00018020 predicted 590
16 SASI_Hs01_00018021 predicted 1225
17 SASI_Hs01_00018022 predicted 2852
18 SASI_Hs01_00018023 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239979 predicted 2107
2 SASI_Rn02_00239980 predicted 2320
3 SASI_Rn02_00239981 predicted 3707
4 SASI_Rn02_00239982 predicted 3299
5 SASI_Rn02_00239983 predicted 2784
6 SASI_Rn02_00239984 predicted 3265
7 SASI_Rn02_00239985 predicted 4065
8 SASI_Rn02_00239986 predicted 3768
9 SASI_Rn02_00239987 predicted 3181
10 SASI_Rn02_00239988 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072513 predicted 3229
2 SASI_Mm01_00072514 predicted 1966
3 SASI_Mm01_00072515 predicted 2202
4 SASI_Mm01_00072516 predicted 482
5 SASI_Mm02_00343818 predicted 2376
6 SASI_Mm01_00072517 predicted 598
7 SASI_Mm01_00072518 predicted 1304
8 SASI_Mm01_00072519 predicted 1241
9 SASI_Mm01_00072520 predicted 604
10 SASI_Mm01_00072521 predicted 203
11 SASI_Mm01_00072522 predicted 2169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003086
VALIDATED
SNAPC4 MISSION shRNA Bacterial Glycerol Stock
small nuclear RNA activating complex, polypeptide 4, 190kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-3784s1c1
Sequence:CCGGCCAGCCAATATGAACAGGGAACTCGAGTTCCCTGTTCATATTGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-1603s1c1
Sequence:CCGGGCTAAGTTGCTTCAAGCTGTTCTCGAGAACAGCTTGAAGCAACTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003086.1-909s1c1
Sequence:CCGGGCTCCTTGTGACCAAATGGAACTCGAGTTCCATTTGGTCACAAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-3212s1c1
Sequence:CCGGCCGTCTTAAATGTACCGCTCTCTCGAGAGAGCGGTACATTTAAGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-1330s21c1
Sequence:CCGGGATCGGTATCTCAGGAGATTACTCGAGTAATCTCCTGAGATACCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-797s21c1
Sequence:CCGGGGGAGAAGATTTCCAATATTACTCGAGTAATATTGGAAATCTTCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-617s21c1
Sequence:CCGGGATTGCTTCAGCCCAAGTTACCTCGAGGTAACTTGGGCTGAAGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-540s21c1
Sequence:CCGGGGAGCTCCTTGTGACCAAATGCTCGAGCATTTGGTCACAAGGAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-438s21c1
Sequence:CCGGGCACTTCATGAAGCCGTATTTCTCGAGAAATACGGCTTCATGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003086
VALIDATED
SNAPC4 MISSION shRNA shRNA Plasmid DNA
small nuclear RNA activating complex, polypeptide 4, 190kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-3784s1c1
Sequence:CCGGCCAGCCAATATGAACAGGGAACTCGAGTTCCCTGTTCATATTGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-1603s1c1
Sequence:CCGGGCTAAGTTGCTTCAAGCTGTTCTCGAGAACAGCTTGAAGCAACTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003086.1-909s1c1
Sequence:CCGGGCTCCTTGTGACCAAATGGAACTCGAGTTCCATTTGGTCACAAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-3212s1c1
Sequence:CCGGCCGTCTTAAATGTACCGCTCTCTCGAGAGAGCGGTACATTTAAGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-1330s21c1
Sequence:CCGGGATCGGTATCTCAGGAGATTACTCGAGTAATCTCCTGAGATACCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-797s21c1
Sequence:CCGGGGGAGAAGATTTCCAATATTACTCGAGTAATATTGGAAATCTTCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-617s21c1
Sequence:CCGGGATTGCTTCAGCCCAAGTTACCTCGAGGTAACTTGGGCTGAAGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-540s21c1
Sequence:CCGGGGAGCTCCTTGTGACCAAATGCTCGAGCATTTGGTCACAAGGAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-438s21c1
Sequence:CCGGGCACTTCATGAAGCCGTATTTCTCGAGAAATACGGCTTCATGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003086
VALIDATED
SNAPC4 MISSION shRNA Lentiviral Transduction Particles
small nuclear RNA activating complex, polypeptide 4, 190kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-3784s1c1
Sequence:CCGGCCAGCCAATATGAACAGGGAACTCGAGTTCCCTGTTCATATTGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-1603s1c1
Sequence:CCGGGCTAAGTTGCTTCAAGCTGTTCTCGAGAACAGCTTGAAGCAACTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003086.1-909s1c1
Sequence:CCGGGCTCCTTGTGACCAAATGGAACTCGAGTTCCATTTGGTCACAAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003086.1-3212s1c1
Sequence:CCGGCCGTCTTAAATGTACCGCTCTCTCGAGAGAGCGGTACATTTAAGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-1330s21c1
Sequence:CCGGGATCGGTATCTCAGGAGATTACTCGAGTAATCTCCTGAGATACCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-797s21c1
Sequence:CCGGGGGAGAAGATTTCCAATATTACTCGAGTAATATTGGAAATCTTCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-617s21c1
Sequence:CCGGGATTGCTTCAGCCCAAGTTACCTCGAGGTAACTTGGGCTGAAGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-540s21c1
Sequence:CCGGGGAGCTCCTTGTGACCAAATGCTCGAGCATTTGGTCACAAGGAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003086.2-438s21c1
Sequence:CCGGGCACTTCATGAAGCCGTATTTCTCGAGAAATACGGCTTCATGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172339
SNAPC4 MISSION shRNA Bacterial Glycerol Stock
small nuclear RNA activating complex, polypeptide 4, 190kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172339.1-4153s1c1
Sequence:CCGGGCAGTACACAACCCTCAGCAACTCGAGTTGCTGAGGGTTGTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-514s1c1
Sequence:CCGGCCACTTCCTGAAGCCATACTTCTCGAGAAGTATGGCTTCAGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-2370s1c1
Sequence:CCGGCTCCGGTATTCACACTGCTTACTCGAGTAAGCAGTGTGAATACCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-871s1c1
Sequence:CCGGCTGGGAGAAGATTTCCAATATCTCGAGATATTGGAAATCTTCTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-1313s1c1
Sequence:CCGGGCTAAATTGCTTCAAGCTGTTCTCGAGAACAGCTTGAAGCAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-2391s21c1
Sequence:CCGGTCAGCTATTGCAGATTGATACCTCGAGGTATCAATCTGCAATAGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-2118s21c1
Sequence:CCGGGTCTGACCCTGGCAACAATACCTCGAGGTATTGTTGCCAGGGTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-691s21c1
Sequence:CCGGCGTCTGCTTCAGCCCAAATTGCTCGAGCAATTTGGGCTGAAGCAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172339
SNAPC4 MISSION shRNA shRNA Plasmid DNA
small nuclear RNA activating complex, polypeptide 4, 190kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172339.1-4153s1c1
Sequence:CCGGGCAGTACACAACCCTCAGCAACTCGAGTTGCTGAGGGTTGTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-514s1c1
Sequence:CCGGCCACTTCCTGAAGCCATACTTCTCGAGAAGTATGGCTTCAGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-2370s1c1
Sequence:CCGGCTCCGGTATTCACACTGCTTACTCGAGTAAGCAGTGTGAATACCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-871s1c1
Sequence:CCGGCTGGGAGAAGATTTCCAATATCTCGAGATATTGGAAATCTTCTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-1313s1c1
Sequence:CCGGGCTAAATTGCTTCAAGCTGTTCTCGAGAACAGCTTGAAGCAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-2391s21c1
Sequence:CCGGTCAGCTATTGCAGATTGATACCTCGAGGTATCAATCTGCAATAGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-2118s21c1
Sequence:CCGGGTCTGACCCTGGCAACAATACCTCGAGGTATTGTTGCCAGGGTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-691s21c1
Sequence:CCGGCGTCTGCTTCAGCCCAAATTGCTCGAGCAATTTGGGCTGAAGCAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172339
SNAPC4 MISSION shRNA Lentiviral Transduction Particles
small nuclear RNA activating complex, polypeptide 4, 190kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172339.1-4153s1c1
Sequence:CCGGGCAGTACACAACCCTCAGCAACTCGAGTTGCTGAGGGTTGTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-514s1c1
Sequence:CCGGCCACTTCCTGAAGCCATACTTCTCGAGAAGTATGGCTTCAGGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-2370s1c1
Sequence:CCGGCTCCGGTATTCACACTGCTTACTCGAGTAAGCAGTGTGAATACCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-871s1c1
Sequence:CCGGCTGGGAGAAGATTTCCAATATCTCGAGATATTGGAAATCTTCTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172339.1-1313s1c1
Sequence:CCGGGCTAAATTGCTTCAAGCTGTTCTCGAGAACAGCTTGAAGCAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-2391s21c1
Sequence:CCGGTCAGCTATTGCAGATTGATACCTCGAGGTATCAATCTGCAATAGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-2118s21c1
Sequence:CCGGGTCTGACCCTGGCAACAATACCTCGAGGTATTGTTGCCAGGGTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172339.3-691s21c1
Sequence:CCGGCGTCTGCTTCAGCCCAAATTGCTCGAGCAATTTGGGCTGAAGCAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)