EMAIL THIS PAGE TO A FRIEND

SNAPC5

small nuclear RNA activating complex, polypeptide 5, 19kDa

45 Gene Product Result for
Synonyms: SNAP19
UniProtKB ID: O75971, A8K7N6, Q96CF3
Gene ID:
Mouse(330959) small nuclear RNA activating complex, polypeptide 5
Rat(691501) small nuclear RNA activating complex, polypeptide 5
cow(616058) small nuclear RNA activating complex, polypeptide 5, 19kDa
sheep(101102065) small nuclear RNA activating complex, polypeptide 5, 19kDa
domestic guinea pig(100712613) small nuclear RNA activating complex, polypeptide 5, 19kDa
naked mole-rat(101715965) small nuclear RNA activating complex, polypeptide 5, 19kDa
Zebrafish(492409) small nuclear RNA activating complex, polypeptide 5
chicken(415550) small nuclear RNA activating complex, polypeptide 5, 19kDa
domestic cat(101081638) small nuclear RNA activating complex, polypeptide 5, 19kDa
dog(610865) small nuclear RNA activating complex, polypeptide 5, 19kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006049 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118131 MISSION® esiRNA esiRNA human SNAPC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006049 Rosetta Predictions human pricing
NM_001109643 Rosetta Predictions rat pricing
NM_183316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197101 predicted 694
2 SASI_Hs01_00197102 predicted 273
3 SASI_Hs01_00197103 predicted 473
4 SASI_Hs01_00197104 predicted 700
5 SASI_Hs01_00197105 predicted 262
6 SASI_Hs02_00340804 predicted 476
7 SASI_Hs01_00197106 predicted 698
8 SASI_Hs01_00197107 predicted 393
9 SASI_Hs01_00197108 predicted 542
10 SASI_Hs01_00197109 predicted 287
11 SASI_Hs01_00197110 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250362 predicted 398
2 SASI_Rn02_00250363 predicted 391
3 SASI_Rn02_00250364 predicted 331
4 SASI_Rn02_00250365 predicted 404
5 SASI_Rn02_00250366 predicted 330
6 SASI_Rn02_00250367 predicted 178
7 SASI_Rn02_00250368 predicted 210
8 SASI_Rn02_00250369 predicted 650
9 SASI_Rn02_00250370 predicted 111
10 SASI_Rn02_00250371 predicted 125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090212 predicted 360
2 SASI_Mm01_00090213 predicted 638
3 SASI_Mm01_00090215 predicted 235
4 SASI_Mm01_00090216 predicted 207
5 SASI_Mm01_00090217 predicted 518
6 SASI_Mm02_00350442 predicted 92
7 SASI_Mm01_00090218 predicted 124
8 SASI_Mm01_00090219 predicted 133
9 SASI_Mm01_00090220 predicted 451
10 SASI_Mm01_00090221 predicted 225
11 SASI_Mm01_00090214 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006049
VALIDATED
SNAPC5 MISSION shRNA Bacterial Glycerol Stock
small nuclear RNA activating complex, polypeptide 5, 19kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-218s21c1
Sequence:CCGGGATGCTGTCTTCTCACACTGTCTCGAGACAGTGTGAGAAGACAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-356s21c1
Sequence:CCGGAGAAGAATCAGATTCCTAAAGCTCGAGCTTTAGGAATCTGATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-158s21c1
Sequence:CCGGCCGCCTCAAGGTTGAAGAATTCTCGAGAATTCTTCAACCTTGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-382s21c1
Sequence:CCGGGGAAAGCCAGGCTGGTGAAATCTCGAGATTTCACCAGCCTGGCTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-69s1c1
Sequence:CCGGCGACCAGCTGAACCGCCTCAACTCGAGTTGAGGCGGTTCAGCTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-259s21c1
Sequence:CCGGTGTTGGTGCATGTAGACAATGCTCGAGCATTGTCTACATGCACCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006049.1-104s1c1
Sequence:CCGGCCCTCCAATCAATGATCAGTTCTCGAGAACTGATCATTGATTGGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-81s1c1
Sequence:CCGGCCGCCTCAAGGTTGAAGAATTCTCGAGAATTCTTCAACCTTGAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-141s1c1
Sequence:CCGGGATGCTGTCTTCTCACACTGTCTCGAGACAGTGTGAGAAGACAGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-45s1c1
Sequence:CCGGGCTGCGGTTGAAGGCAGCCCTCTCGAGAGGGCTGCCTTCAACCGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006049
VALIDATED
SNAPC5 MISSION shRNA shRNA Plasmid DNA
small nuclear RNA activating complex, polypeptide 5, 19kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-218s21c1
Sequence:CCGGGATGCTGTCTTCTCACACTGTCTCGAGACAGTGTGAGAAGACAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-356s21c1
Sequence:CCGGAGAAGAATCAGATTCCTAAAGCTCGAGCTTTAGGAATCTGATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-158s21c1
Sequence:CCGGCCGCCTCAAGGTTGAAGAATTCTCGAGAATTCTTCAACCTTGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-382s21c1
Sequence:CCGGGGAAAGCCAGGCTGGTGAAATCTCGAGATTTCACCAGCCTGGCTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-69s1c1
Sequence:CCGGCGACCAGCTGAACCGCCTCAACTCGAGTTGAGGCGGTTCAGCTGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-259s21c1
Sequence:CCGGTGTTGGTGCATGTAGACAATGCTCGAGCATTGTCTACATGCACCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006049.1-104s1c1
Sequence:CCGGCCCTCCAATCAATGATCAGTTCTCGAGAACTGATCATTGATTGGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-81s1c1
Sequence:CCGGCCGCCTCAAGGTTGAAGAATTCTCGAGAATTCTTCAACCTTGAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-141s1c1
Sequence:CCGGGATGCTGTCTTCTCACACTGTCTCGAGACAGTGTGAGAAGACAGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-45s1c1
Sequence:CCGGGCTGCGGTTGAAGGCAGCCCTCTCGAGAGGGCTGCCTTCAACCGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006049
VALIDATED
SNAPC5 MISSION shRNA Lentiviral Transduction Particles
small nuclear RNA activating complex, polypeptide 5, 19kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-218s21c1
Sequence:CCGGGATGCTGTCTTCTCACACTGTCTCGAGACAGTGTGAGAAGACAGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-356s21c1
Sequence:CCGGAGAAGAATCAGATTCCTAAAGCTCGAGCTTTAGGAATCTGATTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-158s21c1
Sequence:CCGGCCGCCTCAAGGTTGAAGAATTCTCGAGAATTCTTCAACCTTGAGGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-382s21c1
Sequence:CCGGGGAAAGCCAGGCTGGTGAAATCTCGAGATTTCACCAGCCTGGCTTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-69s1c1
Sequence:CCGGCGACCAGCTGAACCGCCTCAACTCGAGTTGAGGCGGTTCAGCTGGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006049.2-259s21c1
Sequence:CCGGTGTTGGTGCATGTAGACAATGCTCGAGCATTGTCTACATGCACCAACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006049.1-104s1c1
Sequence:CCGGCCCTCCAATCAATGATCAGTTCTCGAGAACTGATCATTGATTGGAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-81s1c1
Sequence:CCGGCCGCCTCAAGGTTGAAGAATTCTCGAGAATTCTTCAACCTTGAGGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-141s1c1
Sequence:CCGGGATGCTGTCTTCTCACACTGTCTCGAGACAGTGTGAGAAGACAGCATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006049.1-45s1c1
Sequence:CCGGGCTGCGGTTGAAGGCAGCCCTCTCGAGAGGGCTGCCTTCAACCGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183316
SNAPC5 MISSION shRNA Bacterial Glycerol Stock
small nuclear RNA activating complex, polypeptide 5, 19kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183316.1-334s1c1
Sequence:CCGGGCAGGGTAGTTATACAAACTACTCGAGTAGTTTGTATAACTACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-183s1c1
Sequence:CCGGGCACCTGAACAGTTATGTGATCTCGAGATCACATAACTGTTCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-219s1c1
Sequence:CCGGGACAACGAAGTGACAATAAATCTCGAGATTTATTGTCACTTCGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-216s1c1
Sequence:CCGGGTAGACAACGAAGTGACAATACTCGAGTATTGTCACTTCGTTGTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-136s1c1
Sequence:CCGGCCATGATAAATTCTCGAGGAACTCGAGTTCCTCGAGAATTTATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183316
SNAPC5 MISSION shRNA shRNA Plasmid DNA
small nuclear RNA activating complex, polypeptide 5, 19kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183316.1-334s1c1
Sequence:CCGGGCAGGGTAGTTATACAAACTACTCGAGTAGTTTGTATAACTACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-183s1c1
Sequence:CCGGGCACCTGAACAGTTATGTGATCTCGAGATCACATAACTGTTCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-219s1c1
Sequence:CCGGGACAACGAAGTGACAATAAATCTCGAGATTTATTGTCACTTCGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-216s1c1
Sequence:CCGGGTAGACAACGAAGTGACAATACTCGAGTATTGTCACTTCGTTGTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-136s1c1
Sequence:CCGGCCATGATAAATTCTCGAGGAACTCGAGTTCCTCGAGAATTTATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183316
SNAPC5 MISSION shRNA Lentiviral Transduction Particles
small nuclear RNA activating complex, polypeptide 5, 19kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183316.1-334s1c1
Sequence:CCGGGCAGGGTAGTTATACAAACTACTCGAGTAGTTTGTATAACTACCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-183s1c1
Sequence:CCGGGCACCTGAACAGTTATGTGATCTCGAGATCACATAACTGTTCAGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-219s1c1
Sequence:CCGGGACAACGAAGTGACAATAAATCTCGAGATTTATTGTCACTTCGTTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-216s1c1
Sequence:CCGGGTAGACAACGAAGTGACAATACTCGAGTATTGTCACTTCGTTGTCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183316.1-136s1c1
Sequence:CCGGCCATGATAAATTCTCGAGGAACTCGAGTTCCTCGAGAATTTATCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)