EMAIL THIS PAGE TO A FRIEND

SNAPIN

SNAP-associated protein

42 Gene Product Result for
Synonyms: BLOC1S7 BLOS7 SNAPAP
UniProtKB ID: O95295, D3DV56, Q5SXU8
Gene ID:
Human(23557) Summary: The protein encoded by this gene is a coiled-coil-forming protein that associates with the SNARE (soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptor) complex of proteins and the BLOC-1 (biogenesis of lysosome-related organelles) complex. Biochemical studies have identified additional binding partners. As part of the SNARE complex, it is required for vesicle docking and fusion and regulates neurotransmitter release. The BLOC-1 complex is required for the biogenesis of specialized organelles such as melanosomes and platelet dense granules. Mutations in gene products that form the BLOC-1 complex have been identified in mouse strains that are models of Hermansky-Pudlak syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(20615) SNAP-associated protein
Rat(295217) SNAP-associated protein
fruit fly(3772677) CG9958 gene product from transcript CG9958-RA
chicken(100858163) SNAP-associated protein
Zebrafish(567959) SNAP-associated protein
domestic cat(101081189) SNAP-associated protein
dog(490456) SNAP-associated protein
naked mole-rat(101715366) SNAP-associated protein
domestic guinea pig(100726040) SNAP-associated protein
cow(511816) SNAP-associated protein
sheep(101123177) SNAP-associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012437 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU043531 MISSION® esiRNA esiRNA targeting mouse Snapin (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012437 Rosetta Predictions human pricing
NM_001025648 Rosetta Predictions rat pricing
NM_133854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205755 predicted 375
2 SASI_Hs01_00205756 predicted 213
3 SASI_Hs01_00205757 predicted 333
4 SASI_Hs01_00205758 predicted 325
5 SASI_Hs01_00205760 predicted 200
6 SASI_Hs01_00205761 predicted 438
7 SASI_Hs02_00344341 predicted 384
8 SASI_Hs01_00205763 predicted 209
9 SASI_Hs01_00205764 predicted 196
10 SASI_Hs02_00344342 predicted 422
11 SASI_Hs01_00205759 predicted 224
12 SASI_Hs01_00205762 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092774 predicted 308
2 SASI_Rn01_00092775 predicted 993
3 SASI_Rn01_00092776 predicted 519
4 SASI_Rn01_00092777 predicted 686
5 SASI_Rn01_00092778 predicted 858
6 SASI_Rn01_00092780 predicted 421
7 SASI_Rn01_00092781 predicted 277
8 SASI_Rn01_00092782 predicted 984
9 SASI_Rn02_00203222 predicted 977
10 SASI_Rn01_00092783 predicted 904
11 SASI_Rn01_00092779 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073476 predicted 756
2 SASI_Mm02_00338915 predicted 840
3 SASI_Mm01_00073477 predicted 923
4 SASI_Mm01_00073478 predicted 915
5 SASI_Mm02_00338916 predicted 192
6 SASI_Mm01_00073479 predicted 339
7 SASI_Mm01_00073480 predicted 850
8 SASI_Mm01_00073481 predicted 220
9 SASI_Mm01_00073482 predicted 930
10 SASI_Mm01_00073483 predicted 898
11 SASI_Mm01_00073484 predicted 501
12 SASI_Mm01_00073485 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012437
VALIDATED
SNAPIN MISSION shRNA Bacterial Glycerol Stock
SNAP-associated protein
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-204s1c1
Sequence:CCGGGCCACAGAACTGTGCCGCATACTCGAGTATGCGGCACAGTTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-179s1c1
Sequence:CCGGGCTCCGGGAACAAATTGACAACTCGAGTTGTCAATTTGTTCCCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012437.3-218s1c1
Sequence:CCGGCCGCATAAATGAGGATCAGAACTCGAGTTCTGATCCTCATTTATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-385s1c1
Sequence:CCGGCAATGCTGGATTCGGGAATTTCTCGAGAAATTCCCGAATCCAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-385s21c1
Sequence:CCGGGAACGACTGAGACGGCTAAACCTCGAGGTTTAGCCGTCTCAGTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-440s21c1
Sequence:CCGGCAATGCTGGATTCGGGAATTTCTCGAGAAATTCCCGAATCCAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-258s1c1
Sequence:CCGGCCCTATGTTAAGAAGCTACTTCTCGAGAAGTAGCTTCTTAACATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012437.4-709s21c1
Sequence:GTACCGGCTCTTGCTTCCTTTCACAAATCTCGAGATTTGTGAAAGGAAGCAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-228s21c1
Sequence:GTACCGGGGTAGAGCTCCGGGAACAAATCTCGAGATTTGTTCCCGGAGCTCTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-480s21c1
Sequence:GTACCGGCAAATAACAGATGAGCCTATGCTCGAGCATAGGCTCATCTGTTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-314s21c1
Sequence:GTACCGGCCTATGTTAAGAAGCTACTTACTCGAGTAAGTAGCTTCTTAACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-621s21c1
Sequence:CCGGGCACTTCGTCTTACCCATTTACTCGAGTAAATGGGTAAGACGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-259s21c1
Sequence:CCGGGCCACAGAACTGTGCCGCATACTCGAGTATGCGGCACAGTTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-342s21c1
Sequence:CCGGGCGACGCGTTGTCTTGGTTAACTCGAGTTAACCAAGACAACGCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012437
VALIDATED
SNAPIN MISSION shRNA shRNA Plasmid DNA
SNAP-associated protein
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-204s1c1
Sequence:CCGGGCCACAGAACTGTGCCGCATACTCGAGTATGCGGCACAGTTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-179s1c1
Sequence:CCGGGCTCCGGGAACAAATTGACAACTCGAGTTGTCAATTTGTTCCCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012437.3-218s1c1
Sequence:CCGGCCGCATAAATGAGGATCAGAACTCGAGTTCTGATCCTCATTTATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-385s1c1
Sequence:CCGGCAATGCTGGATTCGGGAATTTCTCGAGAAATTCCCGAATCCAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-385s21c1
Sequence:CCGGGAACGACTGAGACGGCTAAACCTCGAGGTTTAGCCGTCTCAGTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-440s21c1
Sequence:CCGGCAATGCTGGATTCGGGAATTTCTCGAGAAATTCCCGAATCCAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-258s1c1
Sequence:CCGGCCCTATGTTAAGAAGCTACTTCTCGAGAAGTAGCTTCTTAACATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012437.4-709s21c1
Sequence:GTACCGGCTCTTGCTTCCTTTCACAAATCTCGAGATTTGTGAAAGGAAGCAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-228s21c1
Sequence:GTACCGGGGTAGAGCTCCGGGAACAAATCTCGAGATTTGTTCCCGGAGCTCTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-480s21c1
Sequence:GTACCGGCAAATAACAGATGAGCCTATGCTCGAGCATAGGCTCATCTGTTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-314s21c1
Sequence:GTACCGGCCTATGTTAAGAAGCTACTTACTCGAGTAAGTAGCTTCTTAACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-621s21c1
Sequence:CCGGGCACTTCGTCTTACCCATTTACTCGAGTAAATGGGTAAGACGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-259s21c1
Sequence:CCGGGCCACAGAACTGTGCCGCATACTCGAGTATGCGGCACAGTTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-342s21c1
Sequence:CCGGGCGACGCGTTGTCTTGGTTAACTCGAGTTAACCAAGACAACGCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012437
VALIDATED
SNAPIN MISSION shRNA Lentiviral Transduction Particles
SNAP-associated protein
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-204s1c1
Sequence:CCGGGCCACAGAACTGTGCCGCATACTCGAGTATGCGGCACAGTTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-179s1c1
Sequence:CCGGGCTCCGGGAACAAATTGACAACTCGAGTTGTCAATTTGTTCCCGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012437.3-218s1c1
Sequence:CCGGCCGCATAAATGAGGATCAGAACTCGAGTTCTGATCCTCATTTATGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-385s1c1
Sequence:CCGGCAATGCTGGATTCGGGAATTTCTCGAGAAATTCCCGAATCCAGCATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-385s21c1
Sequence:CCGGGAACGACTGAGACGGCTAAACCTCGAGGTTTAGCCGTCTCAGTCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-440s21c1
Sequence:CCGGCAATGCTGGATTCGGGAATTTCTCGAGAAATTCCCGAATCCAGCATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012437.3-258s1c1
Sequence:CCGGCCCTATGTTAAGAAGCTACTTCTCGAGAAGTAGCTTCTTAACATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012437.4-709s21c1
Sequence:GTACCGGCTCTTGCTTCCTTTCACAAATCTCGAGATTTGTGAAAGGAAGCAAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-228s21c1
Sequence:GTACCGGGGTAGAGCTCCGGGAACAAATCTCGAGATTTGTTCCCGGAGCTCTACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-480s21c1
Sequence:GTACCGGCAAATAACAGATGAGCCTATGCTCGAGCATAGGCTCATCTGTTATTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-314s21c1
Sequence:GTACCGGCCTATGTTAAGAAGCTACTTACTCGAGTAAGTAGCTTCTTAACATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-621s21c1
Sequence:CCGGGCACTTCGTCTTACCCATTTACTCGAGTAAATGGGTAAGACGAAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012437.4-259s21c1
Sequence:CCGGGCCACAGAACTGTGCCGCATACTCGAGTATGCGGCACAGTTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012437.4-342s21c1
Sequence:CCGGGCGACGCGTTGTCTTGGTTAACTCGAGTTAACCAAGACAACGCGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011429
VALIDATED
SNAPIN MISSION shRNA Bacterial Glycerol Stock
SNAP-associated protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-166s1c1
Sequence:CCGGGAACAAATTGACAACCTAGCTCTCGAGAGCTAGGTTGTCAATTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-169s1c1
Sequence:CCGGCAAATTGACAACCTAGCTACACTCGAGTGTAGCTAGGTTGTCAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-201s1c1
Sequence:CCGGGATCAATGAGGATCAGAAAGTCTCGAGACTTTCTGATCCTCATTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-162s1c1
Sequence:CCGGCCGGGAACAAATTGACAACCTCTCGAGAGGTTGTCAATTTGTTCCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-177s1c1
Sequence:CCGGCAACCTAGCTACAGAACTGTGCTCGAGCACAGTTCTGTAGCTAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-238s1c1
Sequence:CCGGCCCTATGTTAAGAAGCTGCTTCTCGAGAAGCAGCTTCTTAACATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-160s1c1
Sequence:CCGGCTCCGGGAACAAATTGACAACCTCGAGGTTGTCAATTTGTTCCCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011429
VALIDATED
SNAPIN MISSION shRNA shRNA Plasmid DNA
SNAP-associated protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-166s1c1
Sequence:CCGGGAACAAATTGACAACCTAGCTCTCGAGAGCTAGGTTGTCAATTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-169s1c1
Sequence:CCGGCAAATTGACAACCTAGCTACACTCGAGTGTAGCTAGGTTGTCAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-201s1c1
Sequence:CCGGGATCAATGAGGATCAGAAAGTCTCGAGACTTTCTGATCCTCATTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-162s1c1
Sequence:CCGGCCGGGAACAAATTGACAACCTCTCGAGAGGTTGTCAATTTGTTCCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-177s1c1
Sequence:CCGGCAACCTAGCTACAGAACTGTGCTCGAGCACAGTTCTGTAGCTAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-238s1c1
Sequence:CCGGCCCTATGTTAAGAAGCTGCTTCTCGAGAAGCAGCTTCTTAACATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-160s1c1
Sequence:CCGGCTCCGGGAACAAATTGACAACCTCGAGGTTGTCAATTTGTTCCCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011429
VALIDATED
SNAPIN MISSION shRNA Lentiviral Transduction Particles
SNAP-associated protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-166s1c1
Sequence:CCGGGAACAAATTGACAACCTAGCTCTCGAGAGCTAGGTTGTCAATTTGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-169s1c1
Sequence:CCGGCAAATTGACAACCTAGCTACACTCGAGTGTAGCTAGGTTGTCAATTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-201s1c1
Sequence:CCGGGATCAATGAGGATCAGAAAGTCTCGAGACTTTCTGATCCTCATTGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-162s1c1
Sequence:CCGGCCGGGAACAAATTGACAACCTCTCGAGAGGTTGTCAATTTGTTCCCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011429.1-177s1c1
Sequence:CCGGCAACCTAGCTACAGAACTGTGCTCGAGCACAGTTCTGTAGCTAGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-238s1c1
Sequence:CCGGCCCTATGTTAAGAAGCTGCTTCTCGAGAAGCAGCTTCTTAACATAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011429.1-160s1c1
Sequence:CCGGCTCCGGGAACAAATTGACAACCTCGAGGTTGTCAATTTGTTCCCGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133854
VALIDATED
SNAPIN MISSION shRNA Bacterial Glycerol Stock
SNAP-associated protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-231s21c1
Sequence:CCGGGATCAATGAGGATCAGAAAGTCTCGAGACTTTCTGATCCTCATTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-207s21c1
Sequence:CCGGCAACCTAGCTACAGAACTGTGCTCGAGCACAGTTCTGTAGCTAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133854.2-340s21c1
Sequence:CCGGGAACGACTAAGGCGGTTAAACCTCGAGGTTTAACCGCCTTAGTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133854.2-931s1c1
Sequence:CCGGGGATCATCTTACACTCTATAACTCGAGTTATAGAGTGTAAGATGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133854.2-1376s1c1
Sequence:CCGGCCATCCTGTTACTCCTATTACCTCGAGGTAATAGGAGTAACAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-771s21c1
Sequence:CCGGCCGGGCTCAAGCCTCTATATACTCGAGTATATAGAGGCTTGAGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-196s21c1
Sequence:CCGGGAACAAATTGACAACCTAGCTCTCGAGAGCTAGGTTGTCAATTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133854
VALIDATED
SNAPIN MISSION shRNA shRNA Plasmid DNA
SNAP-associated protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-231s21c1
Sequence:CCGGGATCAATGAGGATCAGAAAGTCTCGAGACTTTCTGATCCTCATTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-207s21c1
Sequence:CCGGCAACCTAGCTACAGAACTGTGCTCGAGCACAGTTCTGTAGCTAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133854.2-340s21c1
Sequence:CCGGGAACGACTAAGGCGGTTAAACCTCGAGGTTTAACCGCCTTAGTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133854.2-931s1c1
Sequence:CCGGGGATCATCTTACACTCTATAACTCGAGTTATAGAGTGTAAGATGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133854.2-1376s1c1
Sequence:CCGGCCATCCTGTTACTCCTATTACCTCGAGGTAATAGGAGTAACAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-771s21c1
Sequence:CCGGCCGGGCTCAAGCCTCTATATACTCGAGTATATAGAGGCTTGAGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-196s21c1
Sequence:CCGGGAACAAATTGACAACCTAGCTCTCGAGAGCTAGGTTGTCAATTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133854
VALIDATED
SNAPIN MISSION shRNA Lentiviral Transduction Particles
SNAP-associated protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-231s21c1
Sequence:CCGGGATCAATGAGGATCAGAAAGTCTCGAGACTTTCTGATCCTCATTGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-207s21c1
Sequence:CCGGCAACCTAGCTACAGAACTGTGCTCGAGCACAGTTCTGTAGCTAGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133854.2-340s21c1
Sequence:CCGGGAACGACTAAGGCGGTTAAACCTCGAGGTTTAACCGCCTTAGTCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133854.2-931s1c1
Sequence:CCGGGGATCATCTTACACTCTATAACTCGAGTTATAGAGTGTAAGATGATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133854.2-1376s1c1
Sequence:CCGGCCATCCTGTTACTCCTATTACCTCGAGGTAATAGGAGTAACAGGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-771s21c1
Sequence:CCGGCCGGGCTCAAGCCTCTATATACTCGAGTATATAGAGGCTTGAGCCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133854.2-196s21c1
Sequence:CCGGGAACAAATTGACAACCTAGCTCTCGAGAGCTAGGTTGTCAATTTGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)