EMAIL THIS PAGE TO A FRIEND

SNF8

SNF8, ESCRT-II complex subunit

47 Gene Product Result for
Synonyms: Dot3 EAP30 VPS22
UniProtKB ID: Q96H20, Q8IXY3, Q9UN50
Gene ID:
Human(11267) Summary: SNF8, VPS25 (MIM 610907), and VPS36 (MIM 610903) form ESCRT-II (endosomal sorting complex required for transport II), a complex involved in endocytosis of ubiquitinated membrane proteins. SNF8, VPS25, and VPS36 are also associated in a multiprotein complex with RNA polymerase II elongation factor (ELL; MIM 600284) (Slagsvold et al., 2005 [PubMed 15755741]
Mouse(27681) SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
Rat(287645) SNF8, ESCRT-II complex subunit
Zebrafish(492771) SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
dog(491063) SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
domestic cat(101096857) SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
chicken(419990) SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
cow(505628) SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
sheep(101113773) SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
domestic guinea pig(100714288) SNF8, ESCRT-II complex subunit
naked mole-rat(101716552) SNF8, ESCRT-II complex subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007241 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007241 Rosetta Predictions human pricing
NM_001007804 Rosetta Predictions rat pricing
NM_033568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099196 predicted 358
2 SASI_Hs01_00099197 predicted 351
3 SASI_Hs01_00099198 predicted 395
4 SASI_Hs01_00099199 predicted 641
5 SASI_Hs01_00099200 predicted 626
6 SASI_Hs01_00099201 predicted 263
7 SASI_Hs01_00099202 predicted 548
8 SASI_Hs01_00099203 predicted 619
9 SASI_Hs02_00343254 predicted 567
10 SASI_Hs01_00099205 predicted 625
11 SASI_Hs01_00099204 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114229 predicted 490
2 SASI_Rn01_00114230 predicted 336
3 SASI_Rn01_00114231 predicted 360
4 SASI_Rn01_00114232 predicted 359
5 SASI_Rn01_00114234 predicted 398
6 SASI_Rn02_00198969 predicted 484
7 SASI_Rn01_00114235 predicted 519
8 SASI_Rn01_00114236 predicted 517
9 SASI_Rn01_00114237 predicted 533
10 SASI_Rn02_00198970 predicted 368
11 SASI_Rn01_00114233 predicted 467
12 SASI_Rn01_00114238 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050941 predicted 668
2 SASI_Mm01_00050942 predicted 233
3 SASI_Mm01_00050943 predicted 459
4 SASI_Mm01_00050944 predicted 667
5 SASI_Mm02_00337396 predicted 252
6 SASI_Mm01_00050945 predicted 585
7 SASI_Mm01_00050946 predicted 430
8 SASI_Mm01_00050947 predicted 692
9 SASI_Mm01_00050948 predicted 220
10 SASI_Mm01_00050949 predicted 596
11 SASI_Mm01_00050950 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033568
VALIDATED
SNF8 MISSION shRNA Bacterial Glycerol Stock
SNF8, ESCRT-II complex subunit
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-397s1c1
Sequence:CCGGCTGGGTGTCCAGATTATTGAACTCGAGTTCAATAATCTGGACACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033568.1-237s1c1
Sequence:CCGGCCTAGAAGAATTTGCCAGCAACTCGAGTTGCTGGCAAATTCTTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-216s1c1
Sequence:CCGGGCTGGACATGTTCAAGACCAACTCGAGTTGGTCTTGAACATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-625s1c1
Sequence:CCGGCTCAATATGGATCACACTGTTCTCGAGAACAGTGTGATCCATATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-466s1c1
Sequence:CCGGGAGCTACATCAGCAGGTGTTACTCGAGTAACACCTGCTGATGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-214s21c1
Sequence:CCGGGCTGGACATGTTCAAGACCAACTCGAGTTGGTCTTGAACATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-670s21c1
Sequence:GTACCGGGTATGTGACTGTCAGTGAAATCTCGAGATTTCACTGACAGTCACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-702s21c1
Sequence:GTACCGGTTAAATGGGAGACGGAGCGAGCTCGAGCTCGCTCCGTCTCCCATTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-464s21c1
Sequence:CCGGGAGCTACATCAGCAGGTGTTACTCGAGTAACACCTGCTGATGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-623s21c1
Sequence:CCGGCTCAATATGGATCACACTGTTCTCGAGAACAGTGTGATCCATATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-395s21c1
Sequence:CCGGCTGGGTGTCCAGATTATTGAACTCGAGTTCAATAATCTGGACACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033568
VALIDATED
SNF8 MISSION shRNA shRNA Plasmid DNA
SNF8, ESCRT-II complex subunit
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-397s1c1
Sequence:CCGGCTGGGTGTCCAGATTATTGAACTCGAGTTCAATAATCTGGACACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033568.1-237s1c1
Sequence:CCGGCCTAGAAGAATTTGCCAGCAACTCGAGTTGCTGGCAAATTCTTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-216s1c1
Sequence:CCGGGCTGGACATGTTCAAGACCAACTCGAGTTGGTCTTGAACATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-625s1c1
Sequence:CCGGCTCAATATGGATCACACTGTTCTCGAGAACAGTGTGATCCATATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-466s1c1
Sequence:CCGGGAGCTACATCAGCAGGTGTTACTCGAGTAACACCTGCTGATGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-214s21c1
Sequence:CCGGGCTGGACATGTTCAAGACCAACTCGAGTTGGTCTTGAACATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-670s21c1
Sequence:GTACCGGGTATGTGACTGTCAGTGAAATCTCGAGATTTCACTGACAGTCACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-702s21c1
Sequence:GTACCGGTTAAATGGGAGACGGAGCGAGCTCGAGCTCGCTCCGTCTCCCATTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-464s21c1
Sequence:CCGGGAGCTACATCAGCAGGTGTTACTCGAGTAACACCTGCTGATGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-623s21c1
Sequence:CCGGCTCAATATGGATCACACTGTTCTCGAGAACAGTGTGATCCATATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-395s21c1
Sequence:CCGGCTGGGTGTCCAGATTATTGAACTCGAGTTCAATAATCTGGACACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033568
VALIDATED
SNF8 MISSION shRNA Lentiviral Transduction Particles
SNF8, ESCRT-II complex subunit
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-397s1c1
Sequence:CCGGCTGGGTGTCCAGATTATTGAACTCGAGTTCAATAATCTGGACACCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033568.1-237s1c1
Sequence:CCGGCCTAGAAGAATTTGCCAGCAACTCGAGTTGCTGGCAAATTCTTCTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-216s1c1
Sequence:CCGGGCTGGACATGTTCAAGACCAACTCGAGTTGGTCTTGAACATGTCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-625s1c1
Sequence:CCGGCTCAATATGGATCACACTGTTCTCGAGAACAGTGTGATCCATATTGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033568.1-466s1c1
Sequence:CCGGGAGCTACATCAGCAGGTGTTACTCGAGTAACACCTGCTGATGTAGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000331797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-214s21c1
Sequence:CCGGGCTGGACATGTTCAAGACCAACTCGAGTTGGTCTTGAACATGTCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000382504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-670s21c1
Sequence:GTACCGGGTATGTGACTGTCAGTGAAATCTCGAGATTTCACTGACAGTCACATACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-702s21c1
Sequence:GTACCGGTTAAATGGGAGACGGAGCGAGCTCGAGCTCGCTCCGTCTCCCATTTAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-464s21c1
Sequence:CCGGGAGCTACATCAGCAGGTGTTACTCGAGTAACACCTGCTGATGTAGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-623s21c1
Sequence:CCGGCTCAATATGGATCACACTGTTCTCGAGAACAGTGTGATCCATATTGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033568.2-395s21c1
Sequence:CCGGCTGGGTGTCCAGATTATTGAACTCGAGTTCAATAATCTGGACACCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007241
VALIDATED
SNF8 MISSION shRNA Bacterial Glycerol Stock
SNF8, ESCRT-II complex subunit
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007241.2-1010s1c1
Sequence:CCGGCGCTCGTTCAGTAAGCATAATCTCGAGATTATGCTTACTGAACGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-464s1c1
Sequence:CCGGGCCCAGGATGTCAGTCAAGATCTCGAGATCTTGACTGACATCCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007241.2-410s1c1
Sequence:CCGGCTGATAACTTTGGAGGAACTACTCGAGTAGTTCCTCCAAAGTTATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-86s1c1
Sequence:CCGGGCCATCGCCAAGAAGAAACTTCTCGAGAAGTTTCTTCTTGGCGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-645s1c1
Sequence:CCGGGTGAGATCAAAGCCAGTCTTACTCGAGTAAGACTGGCTTTGATCTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007241.2-872s21c1
Sequence:GTACCGGGAGGCGGAGGTGGCAAATAAACTCGAGTTTATTTGCCACCTCCGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-783s21c1
Sequence:GTACCGGACCTCTACTCCCAGGAGATTACTCGAGTAATCTCCTGGGAGTAGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007241.2-410s21c1
Sequence:CCGGCTGATAACTTTGGAGGAACTACTCGAGTAGTTCCTCCAAAGTTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007241.2-352s21c1
Sequence:CCGGCGAACTAGGTGTCCAAATTATCTCGAGATAATTTGGACACCTAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-570s21c1
Sequence:CCGGCTGTTCCAGCTGAGCTCAATACTCGAGTATTGAGCTCAGCTGGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-86s21c1
Sequence:CCGGGCCATCGCCAAGAAGAAACTTCTCGAGAAGTTTCTTCTTGGCGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-189s21c1
Sequence:GTACCGGAGACCAACCTGGAGGAATTTGCTCGAGCAAATTCCTCCAGGTTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007241.2-1044s21c1
Sequence:GTACCGGAGAACGGCAAGCACATATAAACTCGAGTTTATATGTGCTTGCCGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007241
VALIDATED
SNF8 MISSION shRNA shRNA Plasmid DNA
SNF8, ESCRT-II complex subunit
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007241.2-1010s1c1
Sequence:CCGGCGCTCGTTCAGTAAGCATAATCTCGAGATTATGCTTACTGAACGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-464s1c1
Sequence:CCGGGCCCAGGATGTCAGTCAAGATCTCGAGATCTTGACTGACATCCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007241.2-410s1c1
Sequence:CCGGCTGATAACTTTGGAGGAACTACTCGAGTAGTTCCTCCAAAGTTATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-86s1c1
Sequence:CCGGGCCATCGCCAAGAAGAAACTTCTCGAGAAGTTTCTTCTTGGCGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-645s1c1
Sequence:CCGGGTGAGATCAAAGCCAGTCTTACTCGAGTAAGACTGGCTTTGATCTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007241.2-872s21c1
Sequence:GTACCGGGAGGCGGAGGTGGCAAATAAACTCGAGTTTATTTGCCACCTCCGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-783s21c1
Sequence:GTACCGGACCTCTACTCCCAGGAGATTACTCGAGTAATCTCCTGGGAGTAGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007241.2-410s21c1
Sequence:CCGGCTGATAACTTTGGAGGAACTACTCGAGTAGTTCCTCCAAAGTTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007241.2-352s21c1
Sequence:CCGGCGAACTAGGTGTCCAAATTATCTCGAGATAATTTGGACACCTAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-570s21c1
Sequence:CCGGCTGTTCCAGCTGAGCTCAATACTCGAGTATTGAGCTCAGCTGGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-86s21c1
Sequence:CCGGGCCATCGCCAAGAAGAAACTTCTCGAGAAGTTTCTTCTTGGCGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-189s21c1
Sequence:GTACCGGAGACCAACCTGGAGGAATTTGCTCGAGCAAATTCCTCCAGGTTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007241.2-1044s21c1
Sequence:GTACCGGAGAACGGCAAGCACATATAAACTCGAGTTTATATGTGCTTGCCGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007241
VALIDATED
SNF8 MISSION shRNA Lentiviral Transduction Particles
SNF8, ESCRT-II complex subunit
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007241.2-1010s1c1
Sequence:CCGGCGCTCGTTCAGTAAGCATAATCTCGAGATTATGCTTACTGAACGAGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-464s1c1
Sequence:CCGGGCCCAGGATGTCAGTCAAGATCTCGAGATCTTGACTGACATCCTGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007241.2-410s1c1
Sequence:CCGGCTGATAACTTTGGAGGAACTACTCGAGTAGTTCCTCCAAAGTTATCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-86s1c1
Sequence:CCGGGCCATCGCCAAGAAGAAACTTCTCGAGAAGTTTCTTCTTGGCGATGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007241.2-645s1c1
Sequence:CCGGGTGAGATCAAAGCCAGTCTTACTCGAGTAAGACTGGCTTTGATCTCACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007241.2-872s21c1
Sequence:GTACCGGGAGGCGGAGGTGGCAAATAAACTCGAGTTTATTTGCCACCTCCGCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-783s21c1
Sequence:GTACCGGACCTCTACTCCCAGGAGATTACTCGAGTAATCTCCTGGGAGTAGAGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000285186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007241.2-410s21c1
Sequence:CCGGCTGATAACTTTGGAGGAACTACTCGAGTAGTTCCTCCAAAGTTATCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000274353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007241.2-352s21c1
Sequence:CCGGCGAACTAGGTGTCCAAATTATCTCGAGATAATTTGGACACCTAGTTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000274378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-570s21c1
Sequence:CCGGCTGTTCCAGCTGAGCTCAATACTCGAGTATTGAGCTCAGCTGGAACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000285189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-86s21c1
Sequence:CCGGGCCATCGCCAAGAAGAAACTTCTCGAGAAGTTTCTTCTTGGCGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000382143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007241.2-189s21c1
Sequence:GTACCGGAGACCAACCTGGAGGAATTTGCTCGAGCAAATTCCTCCAGGTTGGTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000382120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007241.2-1044s21c1
Sequence:GTACCGGAGAACGGCAAGCACATATAAACTCGAGTTTATATGTGCTTGCCGTTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???