EMAIL THIS PAGE TO A FRIEND

SNRNP27

small nuclear ribonucleoprotein 27kDa (U4/U6.U5)

66 Gene Product Result for
Synonyms: 27K RY1
UniProtKB ID: Q8WVK2, Q15410
Gene ID:
Human(11017) Summary: This gene encodes a serine/arginine-rich (SR) protein. SR proteins play important roles in pre-mRNA splicing by facilitating the recognition and selection of splice sites. The encoded protein associates with the 25S U4/U6.U5 tri-snRNP, a major component of the U2-type spiceosome. The expression of this gene may be altered in cells infected with the human T-cell lymphotropic virus type 1 (HTLV-1) retrovirus. A pseudogene of this gene is located on the long arm of chromosome 5. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
Mouse(66618) small nuclear ribonucleoprotein 27 (U4/U6.U5)
Rat(362392) small nuclear ribonucleoprotein 27 (U4/U6.U5)
Zebrafish(436976) small nuclear ribonucleoprotein 27 (U4/U6.U5)
chicken(771295) small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
dog(474626) small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
domestic cat(101094920) small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
naked mole-rat(101698234) small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
domestic guinea pig(100727213) small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
cow(790677) small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
sheep(101115613) small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA034541 Anti-SNRNP27 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006857 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006857 Rosetta Predictions human pricing
NM_001108636 Rosetta Predictions rat pricing
NM_025665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195073 predicted 802
2 SASI_Hs01_00195074 predicted 556
3 SASI_Hs01_00195076 predicted 394
4 SASI_Hs01_00195077 predicted 403
5 SASI_Hs01_00195078 predicted 652
6 SASI_Hs01_00195079 predicted 780
7 SASI_Hs01_00195080 predicted 823
8 SASI_Hs01_00195081 predicted 636
9 SASI_Hs02_00342470 predicted 778
10 SASI_Hs02_00342471 predicted 389
11 SASI_Hs01_00195075 predicted 475
12 SASI_Hs01_00195082 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240579 predicted 503
2 SASI_Rn02_00240580 predicted 617
3 SASI_Rn02_00240581 predicted 624
4 SASI_Rn02_00240582 predicted 509
5 SASI_Rn02_00240583 predicted 532
6 SASI_Rn02_00240584 predicted 508
7 SASI_Rn02_00240585 predicted 534
8 SASI_Rn02_00240586 predicted 601
9 SASI_Rn02_00240587 predicted 498
10 SASI_Rn02_00240588 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105952 predicted 613
2 SASI_Mm01_00105953 predicted 571
3 SASI_Mm01_00105954 predicted 514
4 SASI_Mm01_00105955 predicted 504
5 SASI_Mm01_00105956 predicted 562
6 SASI_Mm01_00105957 predicted 484
7 SASI_Mm01_00105958 predicted 609
8 SASI_Mm01_00105959 predicted 513
9 SASI_Mm01_00105960 predicted 504
10 SASI_Mm01_00105961 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025665
VALIDATED
SNRNP27 MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-517s1c1
Sequence:CCGGCGTCTGGGTCAGAGAGTATTTCTCGAGAAATACTCTCTGACCCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-68s1c1
Sequence:CCGGCATCTCGGGATCGAGAAAGAACTCGAGTTCTTTCTCGATCCCGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-173s1c1
Sequence:CCGGCAAGACGACATAGATCCACATCTCGAGATGTGGATCTATGTCGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-449s1c1
Sequence:CCGGGATTCAACAGACCTCTGGATTCTCGAGAATCCAGAGGTCTGTTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025665.2-372s21c1
Sequence:CCGGGACGGCTCTGTAAATGCCTATCTCGAGATAGGCATTTACAGAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-319s21c1
Sequence:CCGGTGATGAAATTAATGGGATTTGCTCGAGCAAATCCCATTAATTTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-373s1c1
Sequence:CCGGGACGGCTCTGTAAATGCCTATCTCGAGATAGGCATTTACAGAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-418s21c1
Sequence:CCGGAGTACAGGCAGTACATGAATCCTCGAGGATTCATGTACTGCCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-516s21c1
Sequence:CCGGCGTCTGGGTCAGAGAGTATTTCTCGAGAAATACTCTCTGACCCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-448s21c1
Sequence:CCGGGATTCAACAGACCTCTGGATTCTCGAGAATCCAGAGGTCTGTTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025665
VALIDATED
SNRNP27 MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-517s1c1
Sequence:CCGGCGTCTGGGTCAGAGAGTATTTCTCGAGAAATACTCTCTGACCCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-68s1c1
Sequence:CCGGCATCTCGGGATCGAGAAAGAACTCGAGTTCTTTCTCGATCCCGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-173s1c1
Sequence:CCGGCAAGACGACATAGATCCACATCTCGAGATGTGGATCTATGTCGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-449s1c1
Sequence:CCGGGATTCAACAGACCTCTGGATTCTCGAGAATCCAGAGGTCTGTTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025665.2-372s21c1
Sequence:CCGGGACGGCTCTGTAAATGCCTATCTCGAGATAGGCATTTACAGAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-319s21c1
Sequence:CCGGTGATGAAATTAATGGGATTTGCTCGAGCAAATCCCATTAATTTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-373s1c1
Sequence:CCGGGACGGCTCTGTAAATGCCTATCTCGAGATAGGCATTTACAGAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-418s21c1
Sequence:CCGGAGTACAGGCAGTACATGAATCCTCGAGGATTCATGTACTGCCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-516s21c1
Sequence:CCGGCGTCTGGGTCAGAGAGTATTTCTCGAGAAATACTCTCTGACCCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-448s21c1
Sequence:CCGGGATTCAACAGACCTCTGGATTCTCGAGAATCCAGAGGTCTGTTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025665
VALIDATED
SNRNP27 MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-517s1c1
Sequence:CCGGCGTCTGGGTCAGAGAGTATTTCTCGAGAAATACTCTCTGACCCAGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-68s1c1
Sequence:CCGGCATCTCGGGATCGAGAAAGAACTCGAGTTCTTTCTCGATCCCGAGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-173s1c1
Sequence:CCGGCAAGACGACATAGATCCACATCTCGAGATGTGGATCTATGTCGTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-449s1c1
Sequence:CCGGGATTCAACAGACCTCTGGATTCTCGAGAATCCAGAGGTCTGTTGAATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000298278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025665.2-372s21c1
Sequence:CCGGGACGGCTCTGTAAATGCCTATCTCGAGATAGGCATTTACAGAGCCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-319s21c1
Sequence:CCGGTGATGAAATTAATGGGATTTGCTCGAGCAAATCCCATTAATTTCATCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025665.1-373s1c1
Sequence:CCGGGACGGCTCTGTAAATGCCTATCTCGAGATAGGCATTTACAGAGCCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-418s21c1
Sequence:CCGGAGTACAGGCAGTACATGAATCCTCGAGGATTCATGTACTGCCTGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-516s21c1
Sequence:CCGGCGTCTGGGTCAGAGAGTATTTCTCGAGAAATACTCTCTGACCCAGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025665.2-448s21c1
Sequence:CCGGGATTCAACAGACCTCTGGATTCTCGAGAATCCAGAGGTCTGTTGAATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006857
VALIDATED
SNRNP27 MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006857.1-182s1c1
Sequence:CCGGGATCTCCAAGACGACATAGATCTCGAGATCTATGTCGTCTTGGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006857.1-272s1c1
Sequence:CCGGAGAGCAAAGAACGGCAGATTACTCGAGTAATCTGCCGTTCTTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-1191s1c1
Sequence:CCGGCCCACCTATGAGATCAGAATACTCGAGTATTCTGATCTCATAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-397s21c1
Sequence:CCGGGTAAATGCCTATGCCATAAATCTCGAGATTTATGGCATAGGCATTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-179s1c1
Sequence:CCGGCCCGATCTCCAAGACGACATACTCGAGTATGTCGTCTTGGAGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-438s1c1
Sequence:CCGGCAGGCAGTACATGAATCGAAACTCGAGTTTCGATTCATGTACTGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-334s21c1
Sequence:CCGGATGATGAAGTTAATGGGATTTCTCGAGAAATCCCATTAACTTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-465s21c1
Sequence:CCGGATTCAACAGACCTTTGGATTTCTCGAGAAATCCAAAGGTCTGTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-179s21c1
Sequence:CCGGCCCGATCTCCAAGACGACATACTCGAGTATGTCGTCTTGGAGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006857.1-935s21c1
Sequence:CCGGCTTGATTGTTAGTAGTCTAAACTCGAGTTTAGACTACTAACAATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006857
VALIDATED
SNRNP27 MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006857.1-182s1c1
Sequence:CCGGGATCTCCAAGACGACATAGATCTCGAGATCTATGTCGTCTTGGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006857.1-272s1c1
Sequence:CCGGAGAGCAAAGAACGGCAGATTACTCGAGTAATCTGCCGTTCTTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-1191s1c1
Sequence:CCGGCCCACCTATGAGATCAGAATACTCGAGTATTCTGATCTCATAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-397s21c1
Sequence:CCGGGTAAATGCCTATGCCATAAATCTCGAGATTTATGGCATAGGCATTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-179s1c1
Sequence:CCGGCCCGATCTCCAAGACGACATACTCGAGTATGTCGTCTTGGAGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-438s1c1
Sequence:CCGGCAGGCAGTACATGAATCGAAACTCGAGTTTCGATTCATGTACTGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-334s21c1
Sequence:CCGGATGATGAAGTTAATGGGATTTCTCGAGAAATCCCATTAACTTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-465s21c1
Sequence:CCGGATTCAACAGACCTTTGGATTTCTCGAGAAATCCAAAGGTCTGTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-179s21c1
Sequence:CCGGCCCGATCTCCAAGACGACATACTCGAGTATGTCGTCTTGGAGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006857.1-935s21c1
Sequence:CCGGCTTGATTGTTAGTAGTCTAAACTCGAGTTTAGACTACTAACAATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006857
VALIDATED
SNRNP27 MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein 27kDa (U4/U6.U5)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006857.1-182s1c1
Sequence:CCGGGATCTCCAAGACGACATAGATCTCGAGATCTATGTCGTCTTGGAGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006857.1-272s1c1
Sequence:CCGGAGAGCAAAGAACGGCAGATTACTCGAGTAATCTGCCGTTCTTTGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-1191s1c1
Sequence:CCGGCCCACCTATGAGATCAGAATACTCGAGTATTCTGATCTCATAGGTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-397s21c1
Sequence:CCGGGTAAATGCCTATGCCATAAATCTCGAGATTTATGGCATAGGCATTTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-179s1c1
Sequence:CCGGCCCGATCTCCAAGACGACATACTCGAGTATGTCGTCTTGGAGATCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006857.1-438s1c1
Sequence:CCGGCAGGCAGTACATGAATCGAAACTCGAGTTTCGATTCATGTACTGCCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-334s21c1
Sequence:CCGGATGATGAAGTTAATGGGATTTCTCGAGAAATCCCATTAACTTCATCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-465s21c1
Sequence:CCGGATTCAACAGACCTTTGGATTTCTCGAGAAATCCAAAGGTCTGTTGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000286692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006857.1-179s21c1
Sequence:CCGGCCCGATCTCCAAGACGACATACTCGAGTATGTCGTCTTGGAGATCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006857.1-935s21c1
Sequence:CCGGCTTGATTGTTAGTAGTCTAAACTCGAGTTTAGACTACTAACAATCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???