EMAIL THIS PAGE TO A FRIEND

SNRNP70

small nuclear ribonucleoprotein 70kDa (U1)

129 Gene Product Result for
Synonyms: RNPU1Z RPU1 SNRP70 Snp1 U1-70K U170K U1AP U1RNP
Gene ID:
Mouse(20637) small nuclear ribonucleoprotein 70 (U1)
Rat(361574) small nuclear ribonucleoprotein 70 (U1)
Zebrafish(445398) small nuclear ribonucleoprotein 70 (U1)
domestic cat(101100168) small nuclear ribonucleoprotein 70kDa (U1)
dog(484388) small nuclear ribonucleoprotein 70kDa (U1)
naked mole-rat(101710312) small nuclear ribonucleoprotein 70kDa (U1)
domestic guinea pig(100729616) small nuclear ribonucleoprotein 70kDa (U1)
cow(535113) small nuclear ribonucleoprotein 70kDa (U1)
sheep(101109297) small nuclear ribonucleoprotein 70kDa (U1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305762 ANTI-SNRNP70 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA043516 Anti-SNRNP70 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA042050 Anti-SNRNP70 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1100379 Anti-SNRP70 (211-225) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100378 Anti-SNRP70 (86-100) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV40275 Anti-SNRP70 (AB1) antibody produced in rabbit affinity isolated antibody rat, dog, guinea pig, horse, human, bovine, mouse, rabbit
immunohistochemistry, western blot pricing
SAB2102255 Anti-SNRP70 antibody produced in rabbit affinity isolated antibody dog, rat, guinea pig, bovine, rabbit, human
immunohistochemistry, western blot pricing
AV40276 Anti-SNRP70 antibody produced in rabbit IgG fraction of antiserum human, rat, dog, horse, bovine, guinea pig, mouse, rabbit
immunohistochemistry, western blot pricing
06-1297 Anti-U1-70K Antibody clone, from rabbit mouse, human
immunocytochemistry, western blot pricing
05-1588 Anti-U1-70K Antibody, clone 9C4.1 clone 9C4.1, from mouse mouse, human, rat
immunocytochemistry, western blot pricing
03-103 RIPAb+ SNRNP70 - RIP Validated Antibody and Primer Set clone, from rabbit canine, bovine, human, rat, mouse
immunoprecipitation (IP), RIP, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003089 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009820 Rosetta Predictions human pricing
NM_003089 Rosetta Predictions human pricing
NM_001108483 Rosetta Predictions rat pricing
NM_009224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208253 predicted 676
2 SASI_Hs01_00208254 predicted 1222
3 SASI_Hs01_00208255 predicted 1253
4 SASI_Hs01_00208256 predicted 453
5 SASI_Hs01_00208257 predicted 443
6 SASI_Hs01_00208258 predicted 599
7 SASI_Hs01_00208259 predicted 631
8 SASI_Hs01_00208260 predicted 629
9 SASI_Hs01_00208261 predicted 656
10 SASI_Hs01_00208262 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335028 predicted 902
2 SASI_Hs01_00165101 predicted 679
3 SASI_Hs02_00335029 predicted 808
4 SASI_Hs02_00335030 predicted 1057
5 SASI_Hs02_00335031 predicted 898
6 SASI_Hs02_00335032 predicted 893
7 SASI_Hs02_00335033 predicted 746
8 SASI_Hs02_00335034 predicted 871
9 SASI_Hs02_00335035 predicted 1076
10 SASI_Hs01_00165109 predicted 657
11 SASI_Hs01_00165102 predicted 1142
12 SASI_Hs01_00165103 predicted 1176
13 SASI_Hs01_00165104 predicted 458
14 SASI_Hs01_00165105 predicted 453
15 SASI_Hs01_00165106 predicted 601
16 SASI_Hs01_00165107 predicted 624
17 SASI_Hs01_00165108 predicted 629
18 SASI_Hs01_00165110 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239089 predicted 906
2 SASI_Rn02_00239090 predicted 783
3 SASI_Rn02_00239091 predicted 1177
4 SASI_Rn02_00239092 predicted 703
5 SASI_Rn02_00239093 predicted 713
6 SASI_Rn02_00239094 predicted 799
7 SASI_Rn02_00239095 predicted 701
8 SASI_Rn02_00239096 predicted 395
9 SASI_Rn02_00239097 predicted 810
10 SASI_Rn02_00239098 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098948 predicted 458
2 SASI_Mm01_00098949 predicted 582
3 SASI_Mm01_00098950 predicted 611
4 SASI_Mm01_00098951 predicted 609
5 SASI_Mm01_00098953 predicted 450
6 SASI_Mm01_00098955 predicted 613
7 SASI_Mm01_00098956 predicted 592
8 SASI_Mm01_00098957 predicted 518
9 SASI_Mm02_00315667 predicted 449
10 SASI_Mm02_00315668 predicted 496
11 SASI_Mm01_00098952 predicted 779
12 SASI_Mm01_00098954 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009224
VALIDATED
SNRNP70 MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein 70kDa (U1)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-273s1c1
Sequence:CCGGGCACCATACATCCGAGAGTTTCTCGAGAAACTCTCGGATGTATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-588s1c1
Sequence:CCGGGCCTTCATCGAGTATGAGCATCTCGAGATGCTCATACTCGATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-1457s1c1
Sequence:CCGGCCCAGAGAATGGATATCTGATCTCGAGATCAGATATCCATTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-446s1c1
Sequence:CCGGCGATGCCTTCAAGACTCTGTTCTCGAGAACAGAGTCTTGAAGGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-543s21c1
Sequence:CCGGATCCACATGGTATACAGTAAACTCGAGTTTACTGTATACCATGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-588s21c1
Sequence:CCGGGCCTTCATCGAGTATGAGCATCTCGAGATGCTCATACTCGATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-787s21c1
Sequence:CCGGGAGATGACACTTCCCGATATGCTCGAGCATATCGGGAAGTGTCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-446s21c1
Sequence:CCGGCGATGCCTTCAAGACTCTGTTCTCGAGAACAGAGTCTTGAAGGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-273s21c1
Sequence:CCGGGCACCATACATCCGAGAGTTTCTCGAGAAACTCTCGGATGTATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009224
VALIDATED
SNRNP70 MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein 70kDa (U1)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-273s1c1
Sequence:CCGGGCACCATACATCCGAGAGTTTCTCGAGAAACTCTCGGATGTATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-588s1c1
Sequence:CCGGGCCTTCATCGAGTATGAGCATCTCGAGATGCTCATACTCGATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-1457s1c1
Sequence:CCGGCCCAGAGAATGGATATCTGATCTCGAGATCAGATATCCATTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-446s1c1
Sequence:CCGGCGATGCCTTCAAGACTCTGTTCTCGAGAACAGAGTCTTGAAGGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-543s21c1
Sequence:CCGGATCCACATGGTATACAGTAAACTCGAGTTTACTGTATACCATGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-588s21c1
Sequence:CCGGGCCTTCATCGAGTATGAGCATCTCGAGATGCTCATACTCGATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-787s21c1
Sequence:CCGGGAGATGACACTTCCCGATATGCTCGAGCATATCGGGAAGTGTCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-446s21c1
Sequence:CCGGCGATGCCTTCAAGACTCTGTTCTCGAGAACAGAGTCTTGAAGGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-273s21c1
Sequence:CCGGGCACCATACATCCGAGAGTTTCTCGAGAAACTCTCGGATGTATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009224
VALIDATED
SNRNP70 MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein 70kDa (U1)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-273s1c1
Sequence:CCGGGCACCATACATCCGAGAGTTTCTCGAGAAACTCTCGGATGTATGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-588s1c1
Sequence:CCGGGCCTTCATCGAGTATGAGCATCTCGAGATGCTCATACTCGATGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-1457s1c1
Sequence:CCGGCCCAGAGAATGGATATCTGATCTCGAGATCAGATATCCATTCTCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009224.3-446s1c1
Sequence:CCGGCGATGCCTTCAAGACTCTGTTCTCGAGAACAGAGTCTTGAAGGCATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-543s21c1
Sequence:CCGGATCCACATGGTATACAGTAAACTCGAGTTTACTGTATACCATGTGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-588s21c1
Sequence:CCGGGCCTTCATCGAGTATGAGCATCTCGAGATGCTCATACTCGATGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-787s21c1
Sequence:CCGGGAGATGACACTTCCCGATATGCTCGAGCATATCGGGAAGTGTCATCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-446s21c1
Sequence:CCGGCGATGCCTTCAAGACTCTGTTCTCGAGAACAGAGTCTTGAAGGCATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009224.4-273s21c1
Sequence:CCGGGCACCATACATCCGAGAGTTTCTCGAGAAACTCTCGGATGTATGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003089
VALIDATED
SNRNP70 MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein 70kDa (U1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-755s21c1
Sequence:CCGGTTCGTGGCGAGAGTGAATTATCTCGAGATAATTCACTCTCGCCACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-1582s1c1
Sequence:CCGGCCAAGGGTAGGTGTCTCATTTCTCGAGAAATGAGACACCTACCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-646s1c1
Sequence:CCGGTCCGCTTACAAACACGCAGATCTCGAGATCTGCGTGTTTGTAAGCGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-528s1c1
Sequence:CCGGCCGGAGAGAGTTTGAGGTGTACTCGAGTACACCTCAAACTCTCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003089.x-637s1c1
Sequence:CCGGGACATGCACTCCGCTTACAAACTCGAGTTTGTAAGCGGAGTGCATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003089.x-295s1c1
Sequence:CCGGGCGCCGTACATTCGAGAGTTTCTCGAGAAACTCTCGAATGTACGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-905s21c1
Sequence:CCGGGACATGCACTCCGCTTACAAACTCGAGTTTGTAAGCGGAGTGCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-535s21c1
Sequence:CCGGACACCACAATCAACCTTATTGCTCGAGCAATAAGGTTGATTGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-1850s21c1
Sequence:CCGGCCAAGGGTAGGTGTCTCATTTCTCGAGAAATGAGACACCTACCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-914s21c1
Sequence:CCGGTCCGCTTACAAACACGCAGATCTCGAGATCTGCGTGTTTGTAAGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003089
VALIDATED
SNRNP70 MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein 70kDa (U1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-755s21c1
Sequence:CCGGTTCGTGGCGAGAGTGAATTATCTCGAGATAATTCACTCTCGCCACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-1582s1c1
Sequence:CCGGCCAAGGGTAGGTGTCTCATTTCTCGAGAAATGAGACACCTACCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-646s1c1
Sequence:CCGGTCCGCTTACAAACACGCAGATCTCGAGATCTGCGTGTTTGTAAGCGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-528s1c1
Sequence:CCGGCCGGAGAGAGTTTGAGGTGTACTCGAGTACACCTCAAACTCTCTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003089.x-637s1c1
Sequence:CCGGGACATGCACTCCGCTTACAAACTCGAGTTTGTAAGCGGAGTGCATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003089.x-295s1c1
Sequence:CCGGGCGCCGTACATTCGAGAGTTTCTCGAGAAACTCTCGAATGTACGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-905s21c1
Sequence:CCGGGACATGCACTCCGCTTACAAACTCGAGTTTGTAAGCGGAGTGCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-535s21c1
Sequence:CCGGACACCACAATCAACCTTATTGCTCGAGCAATAAGGTTGATTGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-1850s21c1
Sequence:CCGGCCAAGGGTAGGTGTCTCATTTCTCGAGAAATGAGACACCTACCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-914s21c1
Sequence:CCGGTCCGCTTACAAACACGCAGATCTCGAGATCTGCGTGTTTGTAAGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003089
VALIDATED
SNRNP70 MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein 70kDa (U1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-755s21c1
Sequence:CCGGTTCGTGGCGAGAGTGAATTATCTCGAGATAATTCACTCTCGCCACGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-1582s1c1
Sequence:CCGGCCAAGGGTAGGTGTCTCATTTCTCGAGAAATGAGACACCTACCCTTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-646s1c1
Sequence:CCGGTCCGCTTACAAACACGCAGATCTCGAGATCTGCGTGTTTGTAAGCGGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003089.x-528s1c1
Sequence:CCGGCCGGAGAGAGTTTGAGGTGTACTCGAGTACACCTCAAACTCTCTCCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003089.x-637s1c1
Sequence:CCGGGACATGCACTCCGCTTACAAACTCGAGTTTGTAAGCGGAGTGCATGTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003089.x-295s1c1
Sequence:CCGGGCGCCGTACATTCGAGAGTTTCTCGAGAAACTCTCGAATGTACGGCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-905s21c1
Sequence:CCGGGACATGCACTCCGCTTACAAACTCGAGTTTGTAAGCGGAGTGCATGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-535s21c1
Sequence:CCGGACACCACAATCAACCTTATTGCTCGAGCAATAAGGTTGATTGTGGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-1850s21c1
Sequence:CCGGCCAAGGGTAGGTGTCTCATTTCTCGAGAAATGAGACACCTACCCTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003089.4-914s21c1
Sequence:CCGGTCCGCTTACAAACACGCAGATCTCGAGATCTGCGTGTTTGTAAGCGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???