EMAIL THIS PAGE TO A FRIEND

SNRPB2

small nuclear ribonucleoprotein polypeptide B

61 Gene Product Result for
Synonyms: Msl1
UniProtKB ID: P08579, B2R7J3, D3DW21, Q9UJD4
Gene ID:
Human(6629) Summary: The protein encoded by this gene associates with stem loop IV of U2 small nuclear ribonucleoprotein (U2 snRNP) in the presence of snRNP-A'. The encoded protein may play a role in pre-mRNA splicing. Autoantibodies from patients with systemic lupus erythematosus frequently recognize epitopes on the encoded protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20639) U2 small nuclear ribonucleoprotein B
Rat(362223) small nuclear ribonucleoprotein polypeptide B''
Zebrafish(402896) small nuclear ribonucleoprotein polypeptide B2
Horse(100050830) small nuclear ribonucleoprotein polypeptide B
domestic cat(101097472) small nuclear ribonucleoprotein polypeptide B
dog(477148) small nuclear ribonucleoprotein polypeptide B
chicken(421261) small nuclear ribonucleoprotein polypeptide B
naked mole-rat(101708607) small nuclear ribonucleoprotein polypeptide B
domestic guinea pig(100733258) small nuclear ribonucleoprotein polypeptide B
cow(767873) small nuclear ribonucleoprotein polypeptide B
sheep(101112242) small nuclear ribonucleoprotein polypeptide B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198220 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021335 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021335 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021335 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111581 MISSION® esiRNA esiRNA human SNRPB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003092 Rosetta Predictions human pricing
NM_198220 Rosetta Predictions human pricing
NM_001108592 Rosetta Predictions rat pricing
NM_021335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019832 predicted 1023
2 SASI_Hs01_00019835 predicted 1038
3 SASI_Hs01_00019836 predicted 842
4 SASI_Hs02_00335040 predicted 853
5 SASI_Hs01_00019838 predicted 1011
6 SASI_Hs01_00019840 predicted 1029
7 SASI_Hs01_00019841 predicted 873
8 SASI_Hs02_00335041 predicted 820
9 SASI_Hs02_00335042 predicted 879
10 SASI_Hs02_00335043 predicted 920
11 SASI_Hs01_00019833 predicted 1018
12 SASI_Hs01_00019834 predicted 855
13 SASI_Hs01_00019837 predicted 812
14 SASI_Hs01_00019839 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019132 predicted 928
2 SASI_Hs01_00019135 predicted 933
3 SASI_Hs01_00019136 predicted 743
4 SASI_Hs02_00371751 predicted 747
5 SASI_Hs01_00019138 predicted 907
6 SASI_Hs01_00019140 predicted 926
7 SASI_Hs01_00019141 predicted 770
8 SASI_Hs02_00371752 predicted 717
9 SASI_Hs02_00371753 predicted 775
10 SASI_Hs02_00371754 predicted 820
11 SASI_Hs01_00019133 predicted 914
12 SASI_Hs01_00019134 predicted 757
13 SASI_Hs01_00019137 predicted 715
14 SASI_Hs01_00019139 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240159 predicted 612
2 SASI_Rn02_00240160 predicted 607
3 SASI_Rn02_00240161 predicted 609
4 SASI_Rn02_00240162 predicted 607
5 SASI_Rn02_00240163 predicted 607
6 SASI_Rn02_00240164 predicted 603
7 SASI_Rn02_00240165 predicted 608
8 SASI_Rn02_00240166 predicted 611
9 SASI_Rn02_00240167 predicted 611
10 SASI_Rn02_00240168 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164775 predicted 606
2 SASI_Mm01_00164776 predicted 610
3 SASI_Mm01_00164777 predicted 609
4 SASI_Mm01_00164779 predicted 616
5 SASI_Mm01_00164780 predicted 614
6 SASI_Mm01_00164781 predicted 618
7 SASI_Mm01_00164782 predicted 619
8 SASI_Mm01_00164783 predicted 605
9 SASI_Mm01_00164784 predicted 611
10 SASI_Mm01_00164778 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198220
VALIDATED
SNRPB2 MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptide B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-761s1c1
Sequence:CCGGCCATGCTATGAAGATCACCTACTCGAGTAGGTGATCTTCATAGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-597s1c1
Sequence:CCGGGAGACTAATGAGATGATGTTACTCGAGTAACATCATCTCATTAGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-517s1c1
Sequence:CCGGCCCAAGGAAATTCAACACCAACTCGAGTTGGTGTTGAATTTCCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-177s1c1
Sequence:CCGGGAAGAATTGAAGAGATCCCTACTCGAGTAGGGATCTCTTCAATTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-316s1c1
Sequence:CCGGGACAGCTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAGCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-316s21c1
Sequence:CCGGGACAGCTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-597s21c1
Sequence:CCGGGAGACTAATGAGATGATGTTACTCGAGTAACATCATCTCATTAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-517s21c1
Sequence:CCGGCCCAAGGAAATTCAACACCAACTCGAGTTGGTGTTGAATTTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-761s21c1
Sequence:CCGGCCATGCTATGAAGATCACCTACTCGAGTAGGTGATCTTCATAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-177s21c1
Sequence:CCGGGAAGAATTGAAGAGATCCCTACTCGAGTAGGGATCTCTTCAATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198220
VALIDATED
SNRPB2 MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptide B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-761s1c1
Sequence:CCGGCCATGCTATGAAGATCACCTACTCGAGTAGGTGATCTTCATAGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-597s1c1
Sequence:CCGGGAGACTAATGAGATGATGTTACTCGAGTAACATCATCTCATTAGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-517s1c1
Sequence:CCGGCCCAAGGAAATTCAACACCAACTCGAGTTGGTGTTGAATTTCCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-177s1c1
Sequence:CCGGGAAGAATTGAAGAGATCCCTACTCGAGTAGGGATCTCTTCAATTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-316s1c1
Sequence:CCGGGACAGCTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAGCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-316s21c1
Sequence:CCGGGACAGCTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-597s21c1
Sequence:CCGGGAGACTAATGAGATGATGTTACTCGAGTAACATCATCTCATTAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-517s21c1
Sequence:CCGGCCCAAGGAAATTCAACACCAACTCGAGTTGGTGTTGAATTTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-761s21c1
Sequence:CCGGCCATGCTATGAAGATCACCTACTCGAGTAGGTGATCTTCATAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-177s21c1
Sequence:CCGGGAAGAATTGAAGAGATCCCTACTCGAGTAGGGATCTCTTCAATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198220
VALIDATED
SNRPB2 MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptide B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-761s1c1
Sequence:CCGGCCATGCTATGAAGATCACCTACTCGAGTAGGTGATCTTCATAGCATGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-597s1c1
Sequence:CCGGGAGACTAATGAGATGATGTTACTCGAGTAACATCATCTCATTAGTCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-517s1c1
Sequence:CCGGCCCAAGGAAATTCAACACCAACTCGAGTTGGTGTTGAATTTCCTTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-177s1c1
Sequence:CCGGGAAGAATTGAAGAGATCCCTACTCGAGTAGGGATCTCTTCAATTCTTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_198220.1-316s1c1
Sequence:CCGGGACAGCTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAGCTGTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-316s21c1
Sequence:CCGGGACAGCTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAGCTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-597s21c1
Sequence:CCGGGAGACTAATGAGATGATGTTACTCGAGTAACATCATCTCATTAGTCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-517s21c1
Sequence:CCGGCCCAAGGAAATTCAACACCAACTCGAGTTGGTGTTGAATTTCCTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-761s21c1
Sequence:CCGGCCATGCTATGAAGATCACCTACTCGAGTAGGTGATCTTCATAGCATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198220.1-177s21c1
Sequence:CCGGGAAGAATTGAAGAGATCCCTACTCGAGTAGGGATCTCTTCAATTCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021335
VALIDATED
SNRPB2 MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptide B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-242s1c1
Sequence:CCGGCACAAATGCTTTGAGACAGTTCTCGAGAACTGTCTCAAAGCATTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-486s1c1
Sequence:CCGGGTCCCTGATTATCCTCCAAATCTCGAGATTTGGAGGATAATCAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021335.2-1013s1c1
Sequence:CCGGGCAGCTAATGATACAGAAGTTCTCGAGAACTTCTGTATCATTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021335.2-256s1c1
Sequence:CCGGGACAGTTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-488s1c1
Sequence:CCGGCCCTGATTATCCTCCAAATTACTCGAGTAATTTGGAGGATAATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-487s21c1
Sequence:CCGGCCCTGATTATCCTCCAAATTACTCGAGTAATTTGGAGGATAATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021335.3-1012s21c1
Sequence:CCGGGCAGCTAATGATACAGAAGTTCTCGAGAACTTCTGTATCATTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-241s21c1
Sequence:CCGGCACAAATGCTTTGAGACAGTTCTCGAGAACTGTCTCAAAGCATTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-255s21c1
Sequence:CCGGGACAGTTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021335
VALIDATED
SNRPB2 MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptide B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-242s1c1
Sequence:CCGGCACAAATGCTTTGAGACAGTTCTCGAGAACTGTCTCAAAGCATTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-486s1c1
Sequence:CCGGGTCCCTGATTATCCTCCAAATCTCGAGATTTGGAGGATAATCAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021335.2-1013s1c1
Sequence:CCGGGCAGCTAATGATACAGAAGTTCTCGAGAACTTCTGTATCATTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021335.2-256s1c1
Sequence:CCGGGACAGTTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-488s1c1
Sequence:CCGGCCCTGATTATCCTCCAAATTACTCGAGTAATTTGGAGGATAATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-487s21c1
Sequence:CCGGCCCTGATTATCCTCCAAATTACTCGAGTAATTTGGAGGATAATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021335.3-1012s21c1
Sequence:CCGGGCAGCTAATGATACAGAAGTTCTCGAGAACTTCTGTATCATTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-241s21c1
Sequence:CCGGCACAAATGCTTTGAGACAGTTCTCGAGAACTGTCTCAAAGCATTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-255s21c1
Sequence:CCGGGACAGTTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021335
VALIDATED
SNRPB2 MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptide B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-242s1c1
Sequence:CCGGCACAAATGCTTTGAGACAGTTCTCGAGAACTGTCTCAAAGCATTTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-486s1c1
Sequence:CCGGGTCCCTGATTATCCTCCAAATCTCGAGATTTGGAGGATAATCAGGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021335.2-1013s1c1
Sequence:CCGGGCAGCTAATGATACAGAAGTTCTCGAGAACTTCTGTATCATTAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021335.2-256s1c1
Sequence:CCGGGACAGTTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAACTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021335.2-488s1c1
Sequence:CCGGCCCTGATTATCCTCCAAATTACTCGAGTAATTTGGAGGATAATCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000354169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-487s21c1
Sequence:CCGGCCCTGATTATCCTCCAAATTACTCGAGTAATTTGGAGGATAATCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021335.3-1012s21c1
Sequence:CCGGGCAGCTAATGATACAGAAGTTCTCGAGAACTTCTGTATCATTAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-241s21c1
Sequence:CCGGCACAAATGCTTTGAGACAGTTCTCGAGAACTGTCTCAAAGCATTTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021335.3-255s21c1
Sequence:CCGGGACAGTTACAAGGATTTCCATCTCGAGATGGAAATCCTTGTAACTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???