EMAIL THIS PAGE TO A FRIEND

SORBS2

sorbin and SH3 domain containing 2

514 Gene Product Result for
Synonyms: ARGBP2 PRO0618
Gene ID:
Human(8470) Summary: Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(234214) sorbin and SH3 domain containing 2
Rat(114901) sorbin and SH3 domain containing 2
domestic guinea pig(100724374) sorbin and SH3 domain containing 2
naked mole-rat(101713243) sorbin and SH3 domain containing 2
Domestic Rabbit(100344295) sorbin and SH3 domain containing 2
cow(614391) sorbin and SH3 domain containing 2
sheep(101114586) sorbin and SH3 domain containing 2
chicken(422719) sorbin and SH3 domain containing 2
dog(482906) sorbin and SH3 domain containing 2
domestic cat(101093349) sorbin and SH3 domain containing 2
Horse(100050682) sorbin and SH3 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306615 ANTI-ARGBP2(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200037 Anti-SORBS2 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4200038 Anti-SORBS2 (N-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1406674 Anti-SORBS2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA036754 Anti-SORBS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA036755 Anti-SORBS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4200177 Monoclonal Anti-SORBS2 antibody produced in mouse ~1.0 mg/mL, clone S13N, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB4200183 Monoclonal Anti-SORBS2 antibody produced in mouse ~1.0 mg/mL, clone S5C, purified immunoglobulin human, hamster, canine, mouse, rat
immunocytochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070391 MISSION® esiRNA esiRNA human SORBS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003603 Rosetta Predictions human pricing
NM_021069 Rosetta Predictions human pricing
NM_053770 Rosetta Predictions rat pricing
NM_172752 Rosetta Predictions mouse pricing
XM_486103 Rosetta Predictions mouse pricing
XM_896456 Rosetta Predictions mouse pricing
XM_896467 Rosetta Predictions mouse pricing
XM_896488 Rosetta Predictions mouse pricing
XM_896530 Rosetta Predictions mouse pricing
XM_896538 Rosetta Predictions mouse pricing
XM_896544 Rosetta Predictions mouse pricing
XM_896551 Rosetta Predictions mouse pricing
XM_896561 Rosetta Predictions mouse pricing
XM_896567 Rosetta Predictions mouse pricing
XM_896585 Rosetta Predictions mouse pricing
XM_896594 Rosetta Predictions mouse pricing
XM_896601 Rosetta Predictions mouse pricing
XM_896604 Rosetta Predictions mouse pricing
XM_896609 Rosetta Predictions mouse pricing
XM_896621 Rosetta Predictions mouse pricing
XM_896626 Rosetta Predictions mouse pricing
XM_896630 Rosetta Predictions mouse pricing
XM_896637 Rosetta Predictions mouse pricing
XM_896659 Rosetta Predictions mouse pricing
XM_896669 Rosetta Predictions mouse pricing
XM_896678 Rosetta Predictions mouse pricing
XM_896713 Rosetta Predictions mouse pricing
XM_896726 Rosetta Predictions mouse pricing
XM_919630 Rosetta Predictions mouse pricing
XM_993354 Rosetta Predictions mouse pricing
XM_993406 Rosetta Predictions mouse pricing
XM_993497 Rosetta Predictions mouse pricing
XM_993552 Rosetta Predictions mouse pricing
XM_993630 Rosetta Predictions mouse pricing
XM_993781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074063 predicted 2489
2 SASI_Hs01_00074064 predicted 2836
3 SASI_Hs01_00074065 predicted 1307
4 SASI_Hs01_00074066 predicted 2498
5 SASI_Hs01_00074067 predicted 1231
6 SASI_Hs01_00074068 predicted 2336
7 SASI_Hs02_00335939 predicted 2407
8 SASI_Hs01_00074069 predicted 2488
9 SASI_Hs01_00074070 predicted 2307
10 SASI_Hs01_00074071 predicted 2503
11 SASI_Hs01_00074072 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114806 predicted 3551
2 SASI_Hs01_00114807 predicted 3894
3 SASI_Hs01_00114808 predicted 926
4 SASI_Hs01_00114809 predicted 3562
5 SASI_Hs01_00114810 predicted 855
6 SASI_Hs01_00114811 predicted 3389
7 SASI_Hs02_00354541 predicted 3464
8 SASI_Hs01_00114812 predicted 3552
9 SASI_Hs01_00114813 predicted 3359
10 SASI_Hs01_00114814 predicted 3563
11 SASI_Hs01_00114815 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066390 predicted 4354
2 SASI_Rn01_00066392 predicted 4275
3 SASI_Rn02_00266567 predicted 1327
4 SASI_Rn02_00266568 predicted 2170
5 SASI_Rn01_00066393 predicted 1263
6 SASI_Rn01_00066394 predicted 1339
7 SASI_Rn01_00066396 predicted 1437
8 SASI_Rn01_00066397 predicted 760
9 SASI_Rn01_00066398 predicted 2521
10 SASI_Rn01_00066399 predicted 3160
11 SASI_Rn01_00066391 predicted 1031
12 SASI_Rn01_00066395 predicted 3608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344595 predicted 998
2 SASI_Mm02_00344596 predicted 1722
3 SASI_Mm02_00344597 predicted 1708
4 SASI_Mm02_00344598 predicted 3314
5 SASI_Mm02_00344599 predicted 3843
6 SASI_Mm02_00344600 predicted 2621
7 SASI_Mm02_00344601 predicted 430
8 SASI_Mm02_00344602 predicted 2419
9 SASI_Mm02_00344603 predicted 4107
10 SASI_Mm02_00344604 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232708 predicted 304
2 SASI_Mm01_00232709 predicted 314
3 SASI_Mm01_00232710 predicted 415
4 SASI_Mm01_00232711 predicted 350
5 SASI_Mm01_00232712 predicted 305
6 SASI_Mm01_00232713 predicted 397
7 SASI_Mm01_00232714 predicted 351
8 SASI_Mm01_00232715 predicted 792
9 SASI_Mm01_00232716 predicted 1511
10 SASI_Mm01_00232717 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235936 predicted 1290
2 SASI_Mm01_00235937 predicted 1231
3 SASI_Mm01_00235938 predicted 1678
4 SASI_Mm01_00235939 predicted 2343
5 SASI_Mm01_00235940 predicted 2326
6 SASI_Mm01_00235941 predicted 2075
7 SASI_Mm01_00235942 predicted 1592
8 SASI_Mm01_00235943 predicted 2877
9 SASI_Mm01_00235944 predicted 1105
10 SASI_Mm01_00235945 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235552 predicted 652
2 SASI_Mm01_00235553 predicted 585
3 SASI_Mm01_00235554 predicted 989
4 SASI_Mm01_00235555 predicted 1406
5 SASI_Mm01_00235556 predicted 1395
6 SASI_Mm01_00235557 predicted 597
7 SASI_Mm01_00235558 predicted 929
8 SASI_Mm01_00235559 predicted 1942
9 SASI_Mm01_00235560 predicted 451
10 SASI_Mm01_00235561 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227751 predicted 1299
2 SASI_Mm01_00227752 predicted 1187
3 SASI_Mm01_00227753 predicted 1186
4 SASI_Mm01_00227754 predicted 1298
5 SASI_Mm01_00227755 predicted 1229
6 SASI_Mm01_00227756 predicted 1192
7 SASI_Mm01_00227757 predicted 1281
8 SASI_Mm01_00227758 predicted 1232
9 SASI_Mm01_00227759 predicted 1290
10 SASI_Mm01_00227760 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283426 predicted 704
2 SASI_Mm01_00283427 predicted 593
3 SASI_Mm01_00283428 predicted 603
4 SASI_Mm01_00283429 predicted 702
5 SASI_Mm01_00283430 predicted 636
6 SASI_Mm01_00283431 predicted 593
7 SASI_Mm01_00283432 predicted 692
8 SASI_Mm01_00283433 predicted 634
9 SASI_Mm01_00283434 predicted 703
10 SASI_Mm01_00283435 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242781 predicted 1297
2 SASI_Mm01_00242782 predicted 1232
3 SASI_Mm01_00242783 predicted 1678
4 SASI_Mm01_00242784 predicted 2094
5 SASI_Mm01_00242785 predicted 2084
6 SASI_Mm01_00242786 predicted 3683
7 SASI_Mm01_00242787 predicted 4217
8 SASI_Mm01_00242788 predicted 1106
9 SASI_Mm01_00242789 predicted 1546
10 SASI_Mm01_00242790 predicted 2792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255805 predicted 1629
2 SASI_Mm01_00255806 predicted 1728
3 SASI_Mm01_00255807 predicted 1246
4 SASI_Mm01_00255808 predicted 1104
5 SASI_Mm01_00255809 predicted 1543
6 SASI_Mm01_00255810 predicted 1537
7 SASI_Mm01_00255811 predicted 1500
8 SASI_Mm01_00255812 predicted 1407
9 SASI_Mm01_00255813 predicted 1665
10 SASI_Mm01_00255814 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282293 predicted 1010
2 SASI_Mm01_00282294 predicted 1426
3 SASI_Mm01_00282295 predicted 1411
4 SASI_Mm01_00282296 predicted 922
5 SASI_Mm01_00282297 predicted 572
6 SASI_Mm01_00282298 predicted 1961
7 SASI_Mm01_00282299 predicted 880
8 SASI_Mm01_00282300 predicted 863
9 SASI_Mm01_00282301 predicted 939
10 SASI_Mm01_00282302 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250082 predicted 864
2 SASI_Mm01_00250083 predicted 1494
3 SASI_Mm01_00250084 predicted 1485
4 SASI_Mm01_00250085 predicted 808
5 SASI_Mm01_00250086 predicted 2032
6 SASI_Mm01_00250087 predicted 777
7 SASI_Mm01_00250088 predicted 1001
8 SASI_Mm01_00250089 predicted 2111
9 SASI_Mm01_00250090 predicted 2275
10 SASI_Mm01_00250091 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276770 predicted 1300
2 SASI_Mm01_00276771 predicted 1231
3 SASI_Mm01_00276772 predicted 1680
4 SASI_Mm01_00276773 predicted 2313
5 SASI_Mm01_00276774 predicted 2298
6 SASI_Mm01_00276775 predicted 1590
7 SASI_Mm01_00276776 predicted 1248
8 SASI_Mm01_00276777 predicted 2845
9 SASI_Mm01_00276778 predicted 1105
10 SASI_Mm01_00276779 predicted 1552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246790 predicted 1300
2 SASI_Mm01_00246791 predicted 1238
3 SASI_Mm01_00246792 predicted 1630
4 SASI_Mm01_00246793 predicted 2053
5 SASI_Mm01_00246794 predicted 2046
6 SASI_Mm01_00246795 predicted 1242
7 SASI_Mm01_00246796 predicted 1575
8 SASI_Mm01_00246797 predicted 2591
9 SASI_Mm01_00246798 predicted 1106
10 SASI_Mm01_00246799 predicted 1552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249506 predicted 294
2 SASI_Mm01_00249507 predicted 711
3 SASI_Mm01_00249508 predicted 701
4 SASI_Mm01_00249509 predicted 247
5 SASI_Mm01_00249510 predicted 1255
6 SASI_Mm01_00249511 predicted 216
7 SASI_Mm01_00249512 predicted 440
8 SASI_Mm01_00249513 predicted 1324
9 SASI_Mm01_00249514 predicted 1522
10 SASI_Mm01_00249515 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273690 predicted 1016
2 SASI_Mm01_00273691 predicted 1429
3 SASI_Mm01_00273692 predicted 1428
4 SASI_Mm01_00273693 predicted 628
5 SASI_Mm01_00273694 predicted 965
6 SASI_Mm01_00273695 predicted 1969
7 SASI_Mm01_00273696 predicted 933
8 SASI_Mm01_00273697 predicted 2242
9 SASI_Mm01_00273698 predicted 910
10 SASI_Mm01_00273699 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216491 predicted 911
2 SASI_Mm01_00216492 predicted 1638
3 SASI_Mm01_00216493 predicted 1623
4 SASI_Mm01_00216494 predicted 1312
5 SASI_Mm01_00216495 predicted 3223
6 SASI_Mm01_00216496 predicted 3752
7 SASI_Mm01_00216497 predicted 782
8 SASI_Mm01_00216498 predicted 2333
9 SASI_Mm01_00216499 predicted 4020
10 SASI_Mm01_00216500 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224613 predicted 904
2 SASI_Mm01_00224614 predicted 1629
3 SASI_Mm01_00224615 predicted 1620
4 SASI_Mm01_00224616 predicted 1314
5 SASI_Mm01_00224617 predicted 3212
6 SASI_Mm01_00224618 predicted 3746
7 SASI_Mm01_00224619 predicted 777
8 SASI_Mm01_00224620 predicted 2326
9 SASI_Mm01_00224621 predicted 4019
10 SASI_Mm01_00224622 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223778 predicted 331
2 SASI_Mm01_00223779 predicted 334
3 SASI_Mm01_00223780 predicted 438
4 SASI_Mm01_00223781 predicted 378
5 SASI_Mm01_00223782 predicted 339
6 SASI_Mm01_00223783 predicted 429
7 SASI_Mm01_00223784 predicted 379
8 SASI_Mm01_00223785 predicted 820
9 SASI_Mm01_00223786 predicted 1544
10 SASI_Mm01_00223787 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217968 predicted 1072
2 SASI_Mm01_00217969 predicted 1797
3 SASI_Mm01_00217970 predicted 1786
4 SASI_Mm01_00217971 predicted 3384
5 SASI_Mm01_00217972 predicted 3916
6 SASI_Mm01_00217973 predicted 434
7 SASI_Mm01_00217974 predicted 2495
8 SASI_Mm01_00217975 predicted 4183
9 SASI_Mm01_00217976 predicted 934
10 SASI_Mm01_00217977 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238582 predicted 1300
2 SASI_Mm01_00238583 predicted 1238
3 SASI_Mm01_00238584 predicted 1681
4 SASI_Mm01_00238585 predicted 2235
5 SASI_Mm01_00238586 predicted 2230
6 SASI_Mm01_00238587 predicted 1923
7 SASI_Mm01_00238588 predicted 1595
8 SASI_Mm01_00238589 predicted 2776
9 SASI_Mm01_00238590 predicted 1105
10 SASI_Mm01_00238591 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216054 predicted 703
2 SASI_Mm01_00216055 predicted 639
3 SASI_Mm01_00216056 predicted 1043
4 SASI_Mm01_00216057 predicted 1454
5 SASI_Mm01_00216058 predicted 1450
6 SASI_Mm01_00216059 predicted 653
7 SASI_Mm01_00216060 predicted 982
8 SASI_Mm01_00216061 predicted 1993
9 SASI_Mm01_00216062 predicted 512
10 SASI_Mm01_00216063 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240942 predicted 1292
2 SASI_Mm01_00240943 predicted 1230
3 SASI_Mm01_00240944 predicted 1678
4 SASI_Mm01_00240945 predicted 2316
5 SASI_Mm01_00240946 predicted 2299
6 SASI_Mm01_00240947 predicted 1598
7 SASI_Mm01_00240948 predicted 1242
8 SASI_Mm01_00240949 predicted 2850
9 SASI_Mm01_00240950 predicted 1099
10 SASI_Mm01_00240951 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220512 predicted 625
2 SASI_Mm01_00220513 predicted 566
3 SASI_Mm01_00220514 predicted 962
4 SASI_Mm01_00220515 predicted 1377
5 SASI_Mm01_00220516 predicted 1375
6 SASI_Mm01_00220517 predicted 581
7 SASI_Mm01_00220518 predicted 913
8 SASI_Mm01_00220519 predicted 1913
9 SASI_Mm01_00220520 predicted 435
10 SASI_Mm01_00220521 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275730 predicted 1297
2 SASI_Mm01_00275731 predicted 1231
3 SASI_Mm01_00275732 predicted 1634
4 SASI_Mm01_00275733 predicted 2111
5 SASI_Mm01_00275734 predicted 2103
6 SASI_Mm01_00275735 predicted 1251
7 SASI_Mm01_00275736 predicted 1583
8 SASI_Mm01_00275737 predicted 2648
9 SASI_Mm01_00275738 predicted 1106
10 SASI_Mm01_00275739 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219032 predicted 1300
2 SASI_Mm01_00219033 predicted 1236
3 SASI_Mm01_00219034 predicted 1679
4 SASI_Mm01_00219035 predicted 2392
5 SASI_Mm01_00219036 predicted 2392
6 SASI_Mm01_00219037 predicted 3982
7 SASI_Mm01_00219038 predicted 4515
8 SASI_Mm01_00219039 predicted 1096
9 SASI_Mm01_00219040 predicted 1547
10 SASI_Mm01_00219041 predicted 3088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216955 predicted 1298
2 SASI_Mm01_00216956 predicted 1229
3 SASI_Mm01_00216957 predicted 1635
4 SASI_Mm01_00216958 predicted 2048
5 SASI_Mm01_00216959 predicted 2041
6 SASI_Mm01_00216960 predicted 1252
7 SASI_Mm01_00216961 predicted 1580
8 SASI_Mm01_00216962 predicted 2595
9 SASI_Mm01_00216963 predicted 1100
10 SASI_Mm01_00216964 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202475 predicted 1627
2 SASI_Mm01_00202476 predicted 1657
3 SASI_Mm01_00202477 predicted 1520
4 SASI_Mm01_00202478 predicted 1252
5 SASI_Mm01_00202479 predicted 1583
6 SASI_Mm01_00202480 predicted 1097
7 SASI_Mm01_00202481 predicted 1619
8 SASI_Mm01_00202482 predicted 1544
9 SASI_Mm01_00202483 predicted 1774
10 SASI_Mm01_00202484 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275180 predicted 888
2 SASI_Mm01_00275181 predicted 1308
3 SASI_Mm01_00275182 predicted 1302
4 SASI_Mm01_00275183 predicted 511
5 SASI_Mm01_00275184 predicted 837
6 SASI_Mm01_00275185 predicted 1842
7 SASI_Mm01_00275186 predicted 805
8 SASI_Mm01_00275187 predicted 1029
9 SASI_Mm01_00275188 predicted 2114
10 SASI_Mm01_00275189 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268723 predicted 1046
2 SASI_Mm01_00268724 predicted 1764
3 SASI_Mm01_00268725 predicted 1759
4 SASI_Mm01_00268726 predicted 1444
5 SASI_Mm01_00268727 predicted 3361
6 SASI_Mm01_00268728 predicted 3885
7 SASI_Mm01_00268729 predicted 916
8 SASI_Mm01_00268730 predicted 2463
9 SASI_Mm01_00268731 predicted 4152
10 SASI_Mm01_00268732 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226650 predicted 949
2 SASI_Mm01_00226651 predicted 1360
3 SASI_Mm01_00226652 predicted 1358
4 SASI_Mm01_00226653 predicted 557
5 SASI_Mm01_00226654 predicted 888
6 SASI_Mm01_00226655 predicted 1903
7 SASI_Mm01_00226656 predicted 860
8 SASI_Mm01_00226657 predicted 1086
9 SASI_Mm01_00226658 predicted 2175
10 SASI_Mm01_00226659 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236259 predicted 1064
2 SASI_Mm01_00236260 predicted 1777
3 SASI_Mm01_00236261 predicted 1767
4 SASI_Mm01_00236262 predicted 3365
5 SASI_Mm01_00236263 predicted 3894
6 SASI_Mm01_00236264 predicted 927
7 SASI_Mm01_00236265 predicted 2468
8 SASI_Mm01_00236266 predicted 4166
9 SASI_Mm01_00236267 predicted 914
10 SASI_Mm01_00236268 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222098 predicted 885
2 SASI_Mm01_00222099 predicted 833
3 SASI_Mm01_00222100 predicted 1225
4 SASI_Mm01_00222101 predicted 1642
5 SASI_Mm01_00222102 predicted 1639
6 SASI_Mm01_00222103 predicted 842
7 SASI_Mm01_00222104 predicted 1174
8 SASI_Mm01_00222105 predicted 2177
9 SASI_Mm01_00222106 predicted 691
10 SASI_Mm01_00222107 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265083 predicted 1092
2 SASI_Mm01_00265084 predicted 1027
3 SASI_Mm01_00265085 predicted 1430
4 SASI_Mm01_00265086 predicted 1847
5 SASI_Mm01_00265087 predicted 1841
6 SASI_Mm01_00265088 predicted 1042
7 SASI_Mm01_00265089 predicted 1369
8 SASI_Mm01_00265090 predicted 2383
9 SASI_Mm01_00265091 predicted 899
10 SASI_Mm01_00265092 predicted 1338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003603
SORBS2 MISSION shRNA Bacterial Glycerol Stock
sorbin and SH3 domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-1572s21c1
Sequence:CCGGAGACCAACTGATCGCATAAATCTCGAGATTTATGCGATCAGTTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-812s21c1
Sequence:CCGGTCGACCAAACCTACAAGATAACTCGAGTTATCTTGTAGGTTTGGTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-2087s21c1
Sequence:CCGGATCTAAGGAGTTGTCATTTAACTCGAGTTAAATGACAACTCCTTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-2330s21c1
Sequence:CCGGGAGAAAGGGAGATAGAGTTATCTCGAGATAACTCTATCTCCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003603.x-2834s1c1
Sequence:CCGGCGGTTTCCAATGCGGCGTCAACTCGAGTTGACGCCGCATTGGAAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-1702s1c1
Sequence:CCGGCCTCCTTGTATCAGTCCTCTACTCGAGTAGAGGACTGATACAAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-965s1c1
Sequence:CCGGCCTCGATTCCACAGACACATACTCGAGTATGTGTCTGTGGAATCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-2246s1c1
Sequence:CCGGCGGAGAAATCGGAGAAGCTATCTCGAGATAGCTTCTCCGATTTCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-2526s1c1
Sequence:CCGGCGTCCTGTGTTTACTCATGAACTCGAGTTCATGAGTAAACACAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003603
SORBS2 MISSION shRNA shRNA Plasmid DNA
sorbin and SH3 domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-1572s21c1
Sequence:CCGGAGACCAACTGATCGCATAAATCTCGAGATTTATGCGATCAGTTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-812s21c1
Sequence:CCGGTCGACCAAACCTACAAGATAACTCGAGTTATCTTGTAGGTTTGGTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-2087s21c1
Sequence:CCGGATCTAAGGAGTTGTCATTTAACTCGAGTTAAATGACAACTCCTTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-2330s21c1
Sequence:CCGGGAGAAAGGGAGATAGAGTTATCTCGAGATAACTCTATCTCCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003603.x-2834s1c1
Sequence:CCGGCGGTTTCCAATGCGGCGTCAACTCGAGTTGACGCCGCATTGGAAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-1702s1c1
Sequence:CCGGCCTCCTTGTATCAGTCCTCTACTCGAGTAGAGGACTGATACAAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-965s1c1
Sequence:CCGGCCTCGATTCCACAGACACATACTCGAGTATGTGTCTGTGGAATCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-2246s1c1
Sequence:CCGGCGGAGAAATCGGAGAAGCTATCTCGAGATAGCTTCTCCGATTTCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-2526s1c1
Sequence:CCGGCGTCCTGTGTTTACTCATGAACTCGAGTTCATGAGTAAACACAGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003603
SORBS2 MISSION shRNA Lentiviral Transduction Particles
sorbin and SH3 domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-1572s21c1
Sequence:CCGGAGACCAACTGATCGCATAAATCTCGAGATTTATGCGATCAGTTGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-812s21c1
Sequence:CCGGTCGACCAAACCTACAAGATAACTCGAGTTATCTTGTAGGTTTGGTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-2087s21c1
Sequence:CCGGATCTAAGGAGTTGTCATTTAACTCGAGTTAAATGACAACTCCTTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003603.5-2330s21c1
Sequence:CCGGGAGAAAGGGAGATAGAGTTATCTCGAGATAACTCTATCTCCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003603.x-2834s1c1
Sequence:CCGGCGGTTTCCAATGCGGCGTCAACTCGAGTTGACGCCGCATTGGAAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-1702s1c1
Sequence:CCGGCCTCCTTGTATCAGTCCTCTACTCGAGTAGAGGACTGATACAAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-965s1c1
Sequence:CCGGCCTCGATTCCACAGACACATACTCGAGTATGTGTCTGTGGAATCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-2246s1c1
Sequence:CCGGCGGAGAAATCGGAGAAGCTATCTCGAGATAGCTTCTCCGATTTCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003603.x-2526s1c1
Sequence:CCGGCGTCCTGTGTTTACTCATGAACTCGAGTTCATGAGTAAACACAGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172752
SORBS2 MISSION shRNA Bacterial Glycerol Stock
sorbin and SH3 domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-719s21c1
Sequence:CCGGGAAGCTCCATCCCGCTCTATACTCGAGTATAGAGCGGGATGGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-2261s21c1
Sequence:CCGGAGGTCATTTGCTCGGTGAAATCTCGAGATTTCACCGAGCAAATGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-3736s21c1
Sequence:CCGGCGAAAGGGCGACAGGATTATTCTCGAGAATAATCCTGTCGCCCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172752.3-4909s21c1
Sequence:CCGGCAACTGTTACGAGACTATAAACTCGAGTTTATAGTCTCGTAACAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-2377s21c1
Sequence:CCGGCCCACTCGCATTTCGGAATTTCTCGAGAAATTCCGAAATGCGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172752
SORBS2 MISSION shRNA shRNA Plasmid DNA
sorbin and SH3 domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-719s21c1
Sequence:CCGGGAAGCTCCATCCCGCTCTATACTCGAGTATAGAGCGGGATGGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-2261s21c1
Sequence:CCGGAGGTCATTTGCTCGGTGAAATCTCGAGATTTCACCGAGCAAATGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-3736s21c1
Sequence:CCGGCGAAAGGGCGACAGGATTATTCTCGAGAATAATCCTGTCGCCCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172752.3-4909s21c1
Sequence:CCGGCAACTGTTACGAGACTATAAACTCGAGTTTATAGTCTCGTAACAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-2377s21c1
Sequence:CCGGCCCACTCGCATTTCGGAATTTCTCGAGAAATTCCGAAATGCGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172752
SORBS2 MISSION shRNA Lentiviral Transduction Particles
sorbin and SH3 domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-719s21c1
Sequence:CCGGGAAGCTCCATCCCGCTCTATACTCGAGTATAGAGCGGGATGGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-2261s21c1
Sequence:CCGGAGGTCATTTGCTCGGTGAAATCTCGAGATTTCACCGAGCAAATGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-3736s21c1
Sequence:CCGGCGAAAGGGCGACAGGATTATTCTCGAGAATAATCCTGTCGCCCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172752.3-4909s21c1
Sequence:CCGGCAACTGTTACGAGACTATAAACTCGAGTTTATAGTCTCGTAACAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172752.3-2377s21c1
Sequence:CCGGCCCACTCGCATTTCGGAATTTCTCGAGAAATTCCGAAATGCGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)