SPAG5

sperm associated antigen 5

49 Gene Product Result for

Synonyms: DEEPEST MAP126 hMAP126

Species: Human SPAG5(10615), Mouse Spag5(54141), Rat Spag5(252918), cow SPAG5(504585), sheep SPAG5(101105670), naked mole-rat Spag5(101710859), domestic guinea pig Spag5(100725571), chicken SPAG5(771702), Horse SPAG5(100059272), domestic cat SPAG5(101098415), dog SPAG5(480623)

UniProtKB ID: Q96R06, O95213, Q9BWE8, Q9NT17, Q9UFE6

Gene ID:

Human(10615) Summary: This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]

Mouse(54141) sperm associated antigen 5

Rat(252918) sperm associated antigen 5

cow(504585) sperm associated antigen 5

sheep(101105670) sperm associated antigen 5

naked mole-rat(101710859) sperm associated antigen 5

domestic guinea pig(100725571) sperm associated antigen 5

chicken(771702) sperm associated antigen 5

Horse(100059272) sperm associated antigen 5

domestic cat(101098415) sperm associated antigen 5

dog(480623) sperm associated antigen 5

Gene Class: Cytoskeleton

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

HPA022008	Anti-SPAG5 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1	human	immunohistochemistry, western blot	pricing

HPA022479	Anti-SPAG5 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2	human	immunohistochemistry, western blot	pricing

AMAB91605	Monoclonal Anti-SPAG5 antibody produced in mouse Prestige Antibodies^® Powered by Atlas Antibodies, clone CL10078, purified immunoglobulin, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

WH0010615M1	Monoclonal Anti-SPAG5 antibody produced in mouse clone 5F9, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST75531	PrEST Antigen SPAG5 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST75532	PrEST Antigen SPAG5 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST34645	SILu^™PrEST SPAG5 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST34646	SILu^™PrEST SPAG5 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST34647	SILu^™PrEST SPAG5 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_017407	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_017407	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_017407	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_006461	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_006461	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_006461	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU041131	MISSION^® esiRNA targeting human SPAG5	human	pricing

EMU053021	MISSION^® esiRNA targeting mouse Spag5	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_006461	Rosetta Predictions	human	pricing
NM_001044224	Rosetta Predictions	rat	pricing
NM_017407	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_006461	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00208434 predicted	349
2	SASI_Hs01_00208435 predicted	2029
3	SASI_Hs01_00208436 predicted	2346
4	SASI_Hs01_00208437 predicted	3049
5	SASI_Hs01_00208438 predicted	558
6	SASI_Hs01_00208439 predicted	437
7	SASI_Hs01_00208441 predicted	973
8	SASI_Hs01_00208442 predicted	1637
9	SASI_Hs01_00208443 predicted	1133
10	SASI_Hs02_00341613 predicted	2621
11	SASI_Hs01_00208440 predicted	2087

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001044224	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00204967 predicted	2132
2	SASI_Rn02_00204968 predicted	308
3	SASI_Rn02_00204969 predicted	2118
4	SASI_Rn02_00204970 predicted	3519
5	SASI_Rn02_00204971 predicted	3502
6	SASI_Rn02_00204972 predicted	930
7	SASI_Rn02_00204973 predicted	3350
8	SASI_Rn02_00204974 predicted	3541
9	SASI_Rn02_00204975 predicted	2152
10	SASI_Rn02_00204976 predicted	3179

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_017407	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00161720 predicted	2033
2	SASI_Mm01_00161721 predicted	3497
3	SASI_Mm01_00161722 predicted	2950
4	SASI_Mm01_00161723 predicted	2398
5	SASI_Mm01_00161724 predicted	2023
6	SASI_Mm01_00161725 predicted	2284
7	SASI_Mm01_00161727 predicted	3262
8	SASI_Mm01_00161728 predicted	1885
9	SASI_Mm01_00161729 predicted	1012
10	SASI_Mm02_00323923 predicted	1759
11	SASI_Mm01_00161726 predicted	2069

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_017407 VALIDATED	SPAG5 MISSION shRNA Bacterial Glycerol Stock sperm associated antigen 5	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000352464
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-2050s21c1
	Sequence:CCGGGAGGACTGTAAAGGTCAAATCCTCGAGGATTTGACCTTTACAGTCCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340756
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-397s21c1
	Sequence:CCGGGACCCAAGAGATGATAGTATACTCGAGTATACTATCATCTCTTGGGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340816
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-604s21c1
	Sequence:CCGGAGGCCCGAGCAACCTACATTTCTCGAGAAATGTAGGTTGCTCGGGCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340815
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-1382s21c1
	Sequence:CCGGGGGTCACTAAGACACCTAAACCTCGAGGTTTAGGTGTCTTAGTGACCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120643
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017407.1-2041s1c1
	Sequence:CCGGGCCCATTTAGAGGACTGTAAACTCGAGTTTACAGTCCTCTAAATGGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120645
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_017407.1-3405s1c1
	Sequence:CCGGGCGCTCTGACACAGAGTTAAACTCGAGTTTAACTCTGTGTCAGAGCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120644
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017407.1-582s1c1
	Sequence:CCGGCCTAACAGAAATTGTTGCTATCTCGAGATAGCAACAATTTCTGTTAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340814
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-3614s21c1
	Sequence:CCGGCCAGGAATTTGGGAACCTAACCTCGAGGTTAGGTTCCCAAATTCCTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120646
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_017407.1-581s1c1
	Sequence:CCGGGCCTAACAGAAATTGTTGCTACTCGAGTAGCAACAATTTCTGTTAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120642
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_017407.1-3613s1c1
	Sequence:CCGGCCCAGGAATTTGGGAACCTAACTCGAGTTAGGTTCCCAAATTCCTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_017407 VALIDATED	SPAG5 MISSION shRNA shRNA Plasmid DNA sperm associated antigen 5	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000352464
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-2050s21c1
	Sequence:CCGGGAGGACTGTAAAGGTCAAATCCTCGAGGATTTGACCTTTACAGTCCTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000340756
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-397s21c1
	Sequence:CCGGGACCCAAGAGATGATAGTATACTCGAGTATACTATCATCTCTTGGGTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000340816
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-604s21c1
	Sequence:CCGGAGGCCCGAGCAACCTACATTTCTCGAGAAATGTAGGTTGCTCGGGCCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000340815
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-1382s21c1
	Sequence:CCGGGGGTCACTAAGACACCTAAACCTCGAGGTTTAGGTGTCTTAGTGACCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120643
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017407.1-2041s1c1
	Sequence:CCGGGCCCATTTAGAGGACTGTAAACTCGAGTTTACAGTCCTCTAAATGGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120645
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_017407.1-3405s1c1
	Sequence:CCGGGCGCTCTGACACAGAGTTAAACTCGAGTTTAACTCTGTGTCAGAGCGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120644
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017407.1-582s1c1
	Sequence:CCGGCCTAACAGAAATTGTTGCTATCTCGAGATAGCAACAATTTCTGTTAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000340814
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-3614s21c1
	Sequence:CCGGCCAGGAATTTGGGAACCTAACCTCGAGGTTAGGTTCCCAAATTCCTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120646
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_017407.1-581s1c1
	Sequence:CCGGGCCTAACAGAAATTGTTGCTACTCGAGTAGCAACAATTTCTGTTAGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120642
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_017407.1-3613s1c1
	Sequence:CCGGCCCAGGAATTTGGGAACCTAACTCGAGTTAGGTTCCCAAATTCCTGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_017407 VALIDATED	SPAG5 MISSION shRNA Lentiviral Transduction Particles sperm associated antigen 5	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000352464
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-2050s21c1
	Sequence:CCGGGAGGACTGTAAAGGTCAAATCCTCGAGGATTTGACCTTTACAGTCCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340756
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-397s21c1
	Sequence:CCGGGACCCAAGAGATGATAGTATACTCGAGTATACTATCATCTCTTGGGTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340816
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-604s21c1
	Sequence:CCGGAGGCCCGAGCAACCTACATTTCTCGAGAAATGTAGGTTGCTCGGGCCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340815
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-1382s21c1
	Sequence:CCGGGGGTCACTAAGACACCTAAACCTCGAGGTTTAGGTGTCTTAGTGACCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120643
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017407.1-2041s1c1
	Sequence:CCGGGCCCATTTAGAGGACTGTAAACTCGAGTTTACAGTCCTCTAAATGGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120645
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_017407.1-3405s1c1
	Sequence:CCGGGCGCTCTGACACAGAGTTAAACTCGAGTTTAACTCTGTGTCAGAGCGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120644
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017407.1-582s1c1
	Sequence:CCGGCCTAACAGAAATTGTTGCTATCTCGAGATAGCAACAATTTCTGTTAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340814
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_017407.1-3614s21c1
	Sequence:CCGGCCAGGAATTTGGGAACCTAACCTCGAGGTTAGGTTCCCAAATTCCTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120646
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_017407.1-581s1c1
	Sequence:CCGGGCCTAACAGAAATTGTTGCTACTCGAGTAGCAACAATTTCTGTTAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120642
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_017407.1-3613s1c1
	Sequence:CCGGCCCAGGAATTTGGGAACCTAACTCGAGTTAGGTTCCCAAATTCCTGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_006461 VALIDATED	SPAG5 MISSION shRNA Bacterial Glycerol Stock sperm associated antigen 5	Human

13 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000350667
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-2502s21c1
	Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322619
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006461.3-448s21c1
	Sequence:CCGGTAGACCCACTGGGCAATTATACTCGAGTATAATTGCCCAGTGGGTCTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-410s21c1
	Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000152578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006461.2-1021s1c1
	Sequence:CCGGGAGGACTTAGTACCTTCTGAACTCGAGTTCAGAAGGTACTAAGTCCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000153765
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3922s1c1
	Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000154321
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006461.2-3176s1c1
	Sequence:CCGGCCCGAGTAGCATCAATGGTTTCTCGAGAAACCATTGATGCTACTCGGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000155039
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-2737s1c1
	Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000155392
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3784s1c1
	Sequence:CCGGCGCTCTGACAAGGAGTTAGAACTCGAGTTCTAACTCCTTGTCAGAGCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000156202
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3921s1c1
	Sequence:CCGGCCAGAATCTGCTTCACCTCTTCTCGAGAAGAGGTGAAGCAGATTCTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000151718
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-2273s1c1
	Sequence:CCGGCCATGCAACTGGATTATACAACTCGAGTTGTATAATCCAGTTGCATGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000154768
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-1096s1c1
	Sequence:CCGGGCAGCAGATTTCCGTGTCAATCTCGAGATTGACACGGAAATCTGCTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000151895
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-651s1c1
	Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322618
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-3687s21c1
	Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_006461 VALIDATED	SPAG5 MISSION shRNA shRNA Plasmid DNA sperm associated antigen 5	Human

13 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000350667
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-2502s21c1
	Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000322619
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006461.3-448s21c1
	Sequence:CCGGTAGACCCACTGGGCAATTATACTCGAGTATAATTGCCCAGTGGGTCTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000322546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-410s21c1
	Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000152578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006461.2-1021s1c1
	Sequence:CCGGGAGGACTTAGTACCTTCTGAACTCGAGTTCAGAAGGTACTAAGTCCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000153765
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3922s1c1
	Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000154321
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006461.2-3176s1c1
	Sequence:CCGGCCCGAGTAGCATCAATGGTTTCTCGAGAAACCATTGATGCTACTCGGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000155039
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-2737s1c1
	Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000155392
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3784s1c1
	Sequence:CCGGCGCTCTGACAAGGAGTTAGAACTCGAGTTCTAACTCCTTGTCAGAGCGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000156202
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3921s1c1
	Sequence:CCGGCCAGAATCTGCTTCACCTCTTCTCGAGAAGAGGTGAAGCAGATTCTGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000151718
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-2273s1c1
	Sequence:CCGGCCATGCAACTGGATTATACAACTCGAGTTGTATAATCCAGTTGCATGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000154768
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-1096s1c1
	Sequence:CCGGGCAGCAGATTTCCGTGTCAATCTCGAGATTGACACGGAAATCTGCTGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000151895
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-651s1c1
	Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000322618
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-3687s21c1
	Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_006461 VALIDATED	SPAG5 MISSION shRNA Lentiviral Transduction Particles sperm associated antigen 5	Human

13 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000350667
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-2502s21c1
	Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322619
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006461.3-448s21c1
	Sequence:CCGGTAGACCCACTGGGCAATTATACTCGAGTATAATTGCCCAGTGGGTCTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322546
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-410s21c1
	Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000152578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006461.2-1021s1c1
	Sequence:CCGGGAGGACTTAGTACCTTCTGAACTCGAGTTCAGAAGGTACTAAGTCCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000153765
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3922s1c1
	Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000154321
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006461.2-3176s1c1
	Sequence:CCGGCCCGAGTAGCATCAATGGTTTCTCGAGAAACCATTGATGCTACTCGGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000155039
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-2737s1c1
	Sequence:CCGGGAGTTTGCAGACCAGGAGAATCTCGAGATTCTCCTGGTCTGCAAACTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000155392
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3784s1c1
	Sequence:CCGGCGCTCTGACAAGGAGTTAGAACTCGAGTTCTAACTCCTTGTCAGAGCGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000156202
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-3921s1c1
	Sequence:CCGGCCAGAATCTGCTTCACCTCTTCTCGAGAAGAGGTGAAGCAGATTCTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000151718
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-2273s1c1
	Sequence:CCGGCCATGCAACTGGATTATACAACTCGAGTTGTATAATCCAGTTGCATGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000154768
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-1096s1c1
	Sequence:CCGGGCAGCAGATTTCCGTGTCAATCTCGAGATTGACACGGAAATCTGCTGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000151895
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_006461.2-651s1c1
	Sequence:CCGGCCAAATTAGCTCTACTCCTAACTCGAGTTAGGAGTAGAGCTAATTTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322618
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_006461.3-3687s21c1
	Sequence:CCGGCAGAATCTGCTTCACCTCTTTCTCGAGAAAGAGGTGAAGCAGATTCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart