EMAIL THIS PAGE TO A FRIEND

SPATA12

spermatogenesis associated 12

77 Gene Product Result for
Synonyms: SRG5
Species: Human SPATA12(353324)
UniProtKB ID: Q7Z6I5, A0AVA8, B2RMW1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50851 Anti-SPATA12 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181727 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049101 MISSION® esiRNA esiRNA human SPATA12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181727 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028561 predicted 723
2 SASI_Hs01_00028562 predicted 788
3 SASI_Hs01_00028563 predicted 733
4 SASI_Hs01_00028564 predicted 739
5 SASI_Hs01_00028565 predicted 673
6 SASI_Hs01_00028566 predicted 692
7 SASI_Hs01_00028567 predicted 759
8 SASI_Hs01_00028568 predicted 686
9 SASI_Hs01_00028569 predicted 730
10 SASI_Hs01_00028570 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181727
SPATA12 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1157s1c1
Sequence:CCGGGCCGTTCAAACCAACTGACATCTCGAGATGTCAGTTGGTTTGAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-911s1c1
Sequence:CCGGGTGAGACCTGTCAGAGATATTCTCGAGAATATCTCTGACAGGTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1025s1c1
Sequence:CCGGGTTGTGAGCAAGTTATTCATACTCGAGTATGAATAACTTGCTCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1160s1c1
Sequence:CCGGGTTCAAACCAACTGACATTTACTCGAGTAAATGTCAGTTGGTTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181727.1-953s21c1
Sequence:CCGGACATCGCTGTATCCCAAATAACTCGAGTTATTTGGGATACAGCGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181727.1-1509s21c1
Sequence:CCGGGGGAACCTTCACTGTATTAAACTCGAGTTTAATACAGTGAAGGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181727.1-1198s21c1
Sequence:CCGGAGGTCCCTCTCTACAGTATACCTCGAGGTATACTGTAGAGAGGGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181727
SPATA12 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1157s1c1
Sequence:CCGGGCCGTTCAAACCAACTGACATCTCGAGATGTCAGTTGGTTTGAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-911s1c1
Sequence:CCGGGTGAGACCTGTCAGAGATATTCTCGAGAATATCTCTGACAGGTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1025s1c1
Sequence:CCGGGTTGTGAGCAAGTTATTCATACTCGAGTATGAATAACTTGCTCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1160s1c1
Sequence:CCGGGTTCAAACCAACTGACATTTACTCGAGTAAATGTCAGTTGGTTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181727.1-953s21c1
Sequence:CCGGACATCGCTGTATCCCAAATAACTCGAGTTATTTGGGATACAGCGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181727.1-1509s21c1
Sequence:CCGGGGGAACCTTCACTGTATTAAACTCGAGTTTAATACAGTGAAGGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181727.1-1198s21c1
Sequence:CCGGAGGTCCCTCTCTACAGTATACCTCGAGGTATACTGTAGAGAGGGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181727
SPATA12 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1157s1c1
Sequence:CCGGGCCGTTCAAACCAACTGACATCTCGAGATGTCAGTTGGTTTGAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-911s1c1
Sequence:CCGGGTGAGACCTGTCAGAGATATTCTCGAGAATATCTCTGACAGGTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1025s1c1
Sequence:CCGGGTTGTGAGCAAGTTATTCATACTCGAGTATGAATAACTTGCTCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181727.1-1160s1c1
Sequence:CCGGGTTCAAACCAACTGACATTTACTCGAGTAAATGTCAGTTGGTTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181727.1-953s21c1
Sequence:CCGGACATCGCTGTATCCCAAATAACTCGAGTTATTTGGGATACAGCGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181727.1-1509s21c1
Sequence:CCGGGGGAACCTTCACTGTATTAAACTCGAGTTTAATACAGTGAAGGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181727.1-1198s21c1
Sequence:CCGGAGGTCCCTCTCTACAGTATACCTCGAGGTATACTGTAGAGAGGGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)