EMAIL THIS PAGE TO A FRIEND

SPDYE6

speedy/RINGO cell cycle regulator family member E6

4 Gene Product Result for
Species: Human SPDYE6(729597)
UniProtKB ID: P0CI01
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146210 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001131696 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001131696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00388568 predicted 2012
2 SASI_Hs02_00388569 predicted 2040
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146210
SPDYE6 MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member E6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1351s21c1
Sequence:CCGGTAAGCGTCGGTTCCAGTTATACTCGAGTATAACTGGAACCGACGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-547s21c1
Sequence:CCGGGGAGGTGGTGGATGATGAAATCTCGAGATTTCATCATCCACCACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1145s21c1
Sequence:CCGGCAATACCAACGCATTCATTTCCTCGAGGAAATGAATGCGTTGGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1026s21c1
Sequence:CCGGTGCTTGAGGATCCTGTCATTACTCGAGTAATGACAGGATCCTCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146210.1-2004s21c1
Sequence:CCGGACTTGCAGTCCAGGAGGATTTCTCGAGAAATCCTCCTGGACTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146210
SPDYE6 MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member E6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1351s21c1
Sequence:CCGGTAAGCGTCGGTTCCAGTTATACTCGAGTATAACTGGAACCGACGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-547s21c1
Sequence:CCGGGGAGGTGGTGGATGATGAAATCTCGAGATTTCATCATCCACCACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1145s21c1
Sequence:CCGGCAATACCAACGCATTCATTTCCTCGAGGAAATGAATGCGTTGGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1026s21c1
Sequence:CCGGTGCTTGAGGATCCTGTCATTACTCGAGTAATGACAGGATCCTCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146210.1-2004s21c1
Sequence:CCGGACTTGCAGTCCAGGAGGATTTCTCGAGAAATCCTCCTGGACTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146210
SPDYE6 MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member E6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1351s21c1
Sequence:CCGGTAAGCGTCGGTTCCAGTTATACTCGAGTATAACTGGAACCGACGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-547s21c1
Sequence:CCGGGGAGGTGGTGGATGATGAAATCTCGAGATTTCATCATCCACCACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1145s21c1
Sequence:CCGGCAATACCAACGCATTCATTTCCTCGAGGAAATGAATGCGTTGGTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146210.1-1026s21c1
Sequence:CCGGTGCTTGAGGATCCTGTCATTACTCGAGTAATGACAGGATCCTCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146210.1-2004s21c1
Sequence:CCGGACTTGCAGTCCAGGAGGATTTCTCGAGAAATCCTCCTGGACTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)