EMAIL THIS PAGE TO A FRIEND

SPRED2

sprouty-related, EVH1 domain containing 2

100 Gene Product Result for
Synonyms: Spred-2
UniProtKB ID: Q7Z698, A1L3V4, B7Z5K7, D6W5F7, E9PEP0, Q2NKX6
Gene ID:
Human(200734) Summary: SPRED2 is a member of the Sprouty (see SPRY1; MIM 602465)/SPRED family of proteins that regulate growth factor-induced activation of the MAP kinase cascade (see MAPK1; MIM 176948) (Nonami et al., 2004 [PubMed 15465815]
Mouse(114716) sprouty-related, EVH1 domain containing 2
Rat(305539) sprouty-related, EVH1 domain containing 2
domestic guinea pig(100726467) sprouty-related, EVH1 domain containing 2
naked mole-rat(101710811) sprouty-related, EVH1 domain containing 2
Domestic Rabbit(100347387) sprouty-related, EVH1 domain containing 2
cow(519081) sprouty-related, EVH1 domain containing 2
sheep(101117408) sprouty-related, EVH1 domain containing 2
chicken(421271) sprouty-related, EVH1 domain containing 2
dog(481397) sprouty-related, EVH1 domain containing 2
domestic cat(101092176) sprouty-related, EVH1 domain containing 2
Horse(100062947) sprouty-related, EVH1 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128210 Rosetta Predictions human pricing
NM_181784 Rosetta Predictions human pricing
NM_001047094 Rosetta Predictions rat pricing
NM_033523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330846 predicted 382
2 SASI_Hs02_00330847 predicted 205
3 SASI_Hs02_00330848 predicted 532
4 SASI_Hs02_00330849 predicted 220
5 SASI_Hs02_00330850 predicted 467
6 SASI_Hs02_00330851 predicted 371
7 SASI_Hs02_00330852 predicted 541
8 SASI_Hs02_00330853 predicted 401
9 SASI_Hs02_00330854 predicted 1277
10 SASI_Hs02_00330855 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188850 predicted 402
2 SASI_Hs01_00188851 predicted 547
3 SASI_Hs01_00188852 predicted 224
4 SASI_Hs01_00188853 predicted 237
5 SASI_Hs02_00370386 predicted 483
6 SASI_Hs01_00188854 predicted 380
7 SASI_Hs01_00188855 predicted 553
8 SASI_Hs01_00188856 predicted 417
9 SASI_Hs01_00188857 predicted 1290
10 SASI_Hs01_00188858 predicted 1494
11 SASI_Hs01_00188859 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205874 predicted 260
2 SASI_Rn02_00205875 predicted 345
3 SASI_Rn02_00205876 predicted 261
4 SASI_Rn02_00205877 predicted 648
5 SASI_Rn02_00205878 predicted 912
6 SASI_Rn02_00205879 predicted 217
7 SASI_Rn02_00205880 predicted 246
8 SASI_Rn02_00205881 predicted 983
9 SASI_Rn02_00205882 predicted 460
10 SASI_Rn02_00205883 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122022 predicted 517
2 SASI_Mm01_00122023 predicted 529
3 SASI_Mm01_00122024 predicted 1393
4 SASI_Mm01_00122025 predicted 1596
5 SASI_Mm01_00122026 predicted 1253
6 SASI_Mm02_00337382 predicted 709
7 SASI_Mm01_00122027 predicted 1012
8 SASI_Mm01_00122028 predicted 687
9 SASI_Mm01_00122029 predicted 1383
10 SASI_Mm01_00122031 predicted 929
11 SASI_Mm01_00122030 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181784
VALIDATED
SPRED2 MISSION shRNA Bacterial Glycerol Stock
sprouty-related, EVH1 domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1338s21c1
Sequence:CCGGACGTGGACTCCTCAGACTTTGCTCGAGCAAAGTCTGAGGAGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181784.2-2049s21c1
Sequence:CCGGCACAGACTCCTGTACTATTAACTCGAGTTAATAGTACAGGAGTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1013s21c1
Sequence:CCGGGAGCAACCTACTCGGACAATCCTCGAGGATTGTCCGAGTAGGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_181784.2-2252s21c1
Sequence:CCGGAGCATCTGGTTCAGCGGAAATCTCGAGATTTCCGCTGAACCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-801s21c1
Sequence:CCGGATCACTGGAAGGTCGATAATACTCGAGTATTATCGACCTTCCAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1048s21c1
Sequence:CCGGCTGTGAGCACCGGAGGATTTACTCGAGTAAATCCTCCGGTGCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181784.1-548s1c1
Sequence:CCGGGCAATCGAAGACCTTATAGAACTCGAGTTCTATAAGGTCTTCGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-387s1c1
Sequence:CCGGAGAAAGACAAACTGGTGGTATCTCGAGATACCACCAGTTTGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-1321s1c1
Sequence:CCGGCCTCCGGTGGATGGCTCTTATCTCGAGATAAGAGCCATCCACCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181784.1-633s1c1
Sequence:CCGGCAACAGCTACAGACAGTTCTTCTCGAGAAGAACTGTCTGTAGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-226s1c1
Sequence:CCGGCAGCTATATTGTGCGTGTCAACTCGAGTTGACACGCACAATATAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181784
VALIDATED
SPRED2 MISSION shRNA shRNA Plasmid DNA
sprouty-related, EVH1 domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1338s21c1
Sequence:CCGGACGTGGACTCCTCAGACTTTGCTCGAGCAAAGTCTGAGGAGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181784.2-2049s21c1
Sequence:CCGGCACAGACTCCTGTACTATTAACTCGAGTTAATAGTACAGGAGTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1013s21c1
Sequence:CCGGGAGCAACCTACTCGGACAATCCTCGAGGATTGTCCGAGTAGGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_181784.2-2252s21c1
Sequence:CCGGAGCATCTGGTTCAGCGGAAATCTCGAGATTTCCGCTGAACCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-801s21c1
Sequence:CCGGATCACTGGAAGGTCGATAATACTCGAGTATTATCGACCTTCCAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1048s21c1
Sequence:CCGGCTGTGAGCACCGGAGGATTTACTCGAGTAAATCCTCCGGTGCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181784.1-548s1c1
Sequence:CCGGGCAATCGAAGACCTTATAGAACTCGAGTTCTATAAGGTCTTCGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-387s1c1
Sequence:CCGGAGAAAGACAAACTGGTGGTATCTCGAGATACCACCAGTTTGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-1321s1c1
Sequence:CCGGCCTCCGGTGGATGGCTCTTATCTCGAGATAAGAGCCATCCACCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181784.1-633s1c1
Sequence:CCGGCAACAGCTACAGACAGTTCTTCTCGAGAAGAACTGTCTGTAGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-226s1c1
Sequence:CCGGCAGCTATATTGTGCGTGTCAACTCGAGTTGACACGCACAATATAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181784
VALIDATED
SPRED2 MISSION shRNA Lentiviral Transduction Particles
sprouty-related, EVH1 domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1338s21c1
Sequence:CCGGACGTGGACTCCTCAGACTTTGCTCGAGCAAAGTCTGAGGAGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181784.2-2049s21c1
Sequence:CCGGCACAGACTCCTGTACTATTAACTCGAGTTAATAGTACAGGAGTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1013s21c1
Sequence:CCGGGAGCAACCTACTCGGACAATCCTCGAGGATTGTCCGAGTAGGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_181784.2-2252s21c1
Sequence:CCGGAGCATCTGGTTCAGCGGAAATCTCGAGATTTCCGCTGAACCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-801s21c1
Sequence:CCGGATCACTGGAAGGTCGATAATACTCGAGTATTATCGACCTTCCAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181784.2-1048s21c1
Sequence:CCGGCTGTGAGCACCGGAGGATTTACTCGAGTAAATCCTCCGGTGCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181784.1-548s1c1
Sequence:CCGGGCAATCGAAGACCTTATAGAACTCGAGTTCTATAAGGTCTTCGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-387s1c1
Sequence:CCGGAGAAAGACAAACTGGTGGTATCTCGAGATACCACCAGTTTGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-1321s1c1
Sequence:CCGGCCTCCGGTGGATGGCTCTTATCTCGAGATAAGAGCCATCCACCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181784.1-633s1c1
Sequence:CCGGCAACAGCTACAGACAGTTCTTCTCGAGAAGAACTGTCTGTAGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181784.1-226s1c1
Sequence:CCGGCAGCTATATTGTGCGTGTCAACTCGAGTTGACACGCACAATATAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033523
VALIDATED
SPRED2 MISSION shRNA Bacterial Glycerol Stock
sprouty-related, EVH1 domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-1402s21c1
Sequence:CCGGAGGGATATGTTTAATCACGAACTCGAGTTCGTGATTAAACATATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-1541s21c1
Sequence:CCGGGAGACTACACTGACCCTTGTTCTCGAGAACAAGGGTCAGTGTAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-762s21c1
Sequence:CCGGGAAGGTTGATAACAGGAAGTTCTCGAGAACTTCCTGTTATCAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1253s1c1
Sequence:CCGGCCCAAACACGAATATACCTATCTCGAGATAGGTATATTCGTGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-932s1c1
Sequence:CCGGGCTACGGACAGTTCTTCTAATCTCGAGATTAGAAGAACTGTCCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1542s1c1
Sequence:CCGGGAGACTACACTGACCCTTGTTCTCGAGAACAAGGGTCAGTGTAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033523.2-763s1c1
Sequence:CCGGGAAGGTTGATAACAGGAAGTTCTCGAGAACTTCCTGTTATCAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-931s21c1
Sequence:CCGGGCTACGGACAGTTCTTCTAATCTCGAGATTAGAAGAACTGTCCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1403s1c1
Sequence:CCGGAGGGATATGTTTAATCACGAACTCGAGTTCGTGATTAAACATATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033523
VALIDATED
SPRED2 MISSION shRNA shRNA Plasmid DNA
sprouty-related, EVH1 domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-1402s21c1
Sequence:CCGGAGGGATATGTTTAATCACGAACTCGAGTTCGTGATTAAACATATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-1541s21c1
Sequence:CCGGGAGACTACACTGACCCTTGTTCTCGAGAACAAGGGTCAGTGTAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-762s21c1
Sequence:CCGGGAAGGTTGATAACAGGAAGTTCTCGAGAACTTCCTGTTATCAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1253s1c1
Sequence:CCGGCCCAAACACGAATATACCTATCTCGAGATAGGTATATTCGTGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-932s1c1
Sequence:CCGGGCTACGGACAGTTCTTCTAATCTCGAGATTAGAAGAACTGTCCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1542s1c1
Sequence:CCGGGAGACTACACTGACCCTTGTTCTCGAGAACAAGGGTCAGTGTAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033523.2-763s1c1
Sequence:CCGGGAAGGTTGATAACAGGAAGTTCTCGAGAACTTCCTGTTATCAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-931s21c1
Sequence:CCGGGCTACGGACAGTTCTTCTAATCTCGAGATTAGAAGAACTGTCCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1403s1c1
Sequence:CCGGAGGGATATGTTTAATCACGAACTCGAGTTCGTGATTAAACATATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033523
VALIDATED
SPRED2 MISSION shRNA Lentiviral Transduction Particles
sprouty-related, EVH1 domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-1402s21c1
Sequence:CCGGAGGGATATGTTTAATCACGAACTCGAGTTCGTGATTAAACATATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-1541s21c1
Sequence:CCGGGAGACTACACTGACCCTTGTTCTCGAGAACAAGGGTCAGTGTAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-762s21c1
Sequence:CCGGGAAGGTTGATAACAGGAAGTTCTCGAGAACTTCCTGTTATCAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1253s1c1
Sequence:CCGGCCCAAACACGAATATACCTATCTCGAGATAGGTATATTCGTGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-932s1c1
Sequence:CCGGGCTACGGACAGTTCTTCTAATCTCGAGATTAGAAGAACTGTCCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1542s1c1
Sequence:CCGGGAGACTACACTGACCCTTGTTCTCGAGAACAAGGGTCAGTGTAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033523.2-763s1c1
Sequence:CCGGGAAGGTTGATAACAGGAAGTTCTCGAGAACTTCCTGTTATCAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033523.4-931s21c1
Sequence:CCGGGCTACGGACAGTTCTTCTAATCTCGAGATTAGAAGAACTGTCCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033523.2-1403s1c1
Sequence:CCGGAGGGATATGTTTAATCACGAACTCGAGTTCGTGATTAAACATATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)