EMAIL THIS PAGE TO A FRIEND

SRGAP1

SLIT-ROBO Rho GTPase activating protein 1

101 Gene Product Result for
Synonyms: ARHGAP13
UniProtKB ID: Q7Z6B7, Q9H8A3, Q9P2P2
Gene ID:
Mouse(117600) SLIT-ROBO Rho GTPase activating protein 1
Rat(314903) SLIT-ROBO Rho GTPase activating protein 1
Zebrafish(570262) SLIT-ROBO Rho GTPase activating protein 1
Horse(100051440) SLIT-ROBO Rho GTPase activating protein 1
domestic cat(101091214) SLIT-ROBO Rho GTPase activating protein 1
dog(481144) SLIT-ROBO Rho GTPase activating protein 1
chicken(417821) SLIT-ROBO Rho GTPase activating protein 1
cow(539452) SLIT-ROBO Rho GTPase activating protein 1
sheep(101111871) SLIT-ROBO Rho GTPase activating protein 1
domestic guinea pig(100713864) SLIT-ROBO Rho GTPase activating protein 1
naked mole-rat(101715524) SLIT-ROBO Rho GTPase activating protein 1
Domestic Rabbit(100357985) SLIT-ROBO Rho GTPase activating protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020762 Rosetta Predictions human pricing
XM_001053311 Rosetta Predictions rat pricing
XM_235213 Rosetta Predictions rat pricing
NM_001081037 Rosetta Predictions mouse pricing
XM_001004446 Rosetta Predictions mouse pricing
XM_001004448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238705 predicted 1750
2 SASI_Hs01_00238706 predicted 1626
3 SASI_Hs01_00238707 predicted 454
4 SASI_Hs01_00238708 predicted 436
5 SASI_Hs01_00238709 predicted 1541
6 SASI_Hs01_00238711 predicted 3383
7 SASI_Hs01_00238713 predicted 2939
8 SASI_Hs01_00238714 predicted 2847
9 SASI_Hs02_00353884 predicted 3284
10 SASI_Hs02_00353885 predicted 1465
11 SASI_Hs01_00238710 predicted 232
12 SASI_Hs01_00238712 predicted 2301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271914 predicted 1738
2 SASI_Rn02_00271915 predicted 2267
3 SASI_Rn02_00271916 predicted 1297
4 SASI_Rn02_00271917 predicted 1155
5 SASI_Rn02_00271918 predicted 2394
6 SASI_Rn02_00271919 predicted 1493
7 SASI_Rn02_00271920 predicted 1514
8 SASI_Rn02_00271921 predicted 2863
9 SASI_Rn02_00271922 predicted 2056
10 SASI_Rn02_00271923 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389125 predicted 204
2 SASI_Rn02_00389126 predicted 2615
3 SASI_Rn02_00389127 predicted 294
4 SASI_Rn02_00389128 predicted 909
5 SASI_Rn02_00389129 predicted 931
6 SASI_Rn02_00389130 predicted 240
7 SASI_Rn02_00389131 predicted 2884
8 SASI_Rn02_00389132 predicted 2861
9 SASI_Rn02_00389133 predicted 965
10 SASI_Rn02_00389134 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294561 predicted 2859
2 SASI_Mm02_00294562 predicted 842
3 SASI_Mm02_00294563 predicted 2389
4 SASI_Mm02_00294564 predicted 715
5 SASI_Mm02_00294565 predicted 1677
6 SASI_Mm02_00294566 predicted 743
7 SASI_Mm02_00294567 predicted 1995
8 SASI_Mm02_00294568 predicted 382
9 SASI_Mm02_00294569 predicted 721
10 SASI_Mm02_00294570 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242169 predicted 2864
2 SASI_Mm01_00242170 predicted 1415
3 SASI_Mm01_00242171 predicted 848
4 SASI_Mm01_00242172 predicted 2393
5 SASI_Mm01_00242173 predicted 728
6 SASI_Mm01_00242174 predicted 1674
7 SASI_Mm01_00242175 predicted 750
8 SASI_Mm01_00242176 predicted 382
9 SASI_Mm01_00242177 predicted 726
10 SASI_Mm01_00242178 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208038 predicted 284
2 SASI_Mm01_00208039 predicted 1398
3 SASI_Mm01_00208040 predicted 1164
4 SASI_Mm01_00208041 predicted 267
5 SASI_Mm01_00208042 predicted 690
6 SASI_Mm01_00208043 predicted 352
7 SASI_Mm01_00208044 predicted 627
8 SASI_Mm01_00208045 predicted 926
9 SASI_Mm01_00208046 predicted 572
10 SASI_Mm01_00208047 predicted 1364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020762
VALIDATED
SRGAP1 MISSION shRNA Bacterial Glycerol Stock
SLIT-ROBO Rho GTPase activating protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-3467s21c1
Sequence:CCGGGCTAAATTAACACGGGCATTTCTCGAGAAATGCCCGTGTTAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-2161s21c1
Sequence:CCGGGCCCTGTTTATGAGAAATGTACTCGAGTACATTTCTCATAAACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-225s21c1
Sequence:CCGGGCTGAAATTGAGACGGAATATCTCGAGATATTCCGTCTCAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-2571s21c1
Sequence:CCGGCGTCATCCTGACGGCTATTTACTCGAGTAAATAGCCGTCAGGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-1001s21c1
Sequence:CCGGGCAGAGATTCATGGAGATGTACTCGAGTACATCTCCATGAATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020762.1-2161s1c1
Sequence:CCGGGCCCTGTTTATGAGAAATGTACTCGAGTACATTTCTCATAAACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-1541s1c1
Sequence:CCGGCCGCTCACAGTATAATACTAACTCGAGTTAGTATTATACTGTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-2571s1c1
Sequence:CCGGCGTCATCCTGACGGCTATTTACTCGAGTAAATAGCCGTCAGGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-1001s1c1
Sequence:CCGGGCAGAGATTCATGGAGATGTACTCGAGTACATCTCCATGAATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020762.1-225s1c1
Sequence:CCGGGCTGAAATTGAGACGGAATATCTCGAGATATTCCGTCTCAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020762
VALIDATED
SRGAP1 MISSION shRNA shRNA Plasmid DNA
SLIT-ROBO Rho GTPase activating protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-3467s21c1
Sequence:CCGGGCTAAATTAACACGGGCATTTCTCGAGAAATGCCCGTGTTAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-2161s21c1
Sequence:CCGGGCCCTGTTTATGAGAAATGTACTCGAGTACATTTCTCATAAACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-225s21c1
Sequence:CCGGGCTGAAATTGAGACGGAATATCTCGAGATATTCCGTCTCAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-2571s21c1
Sequence:CCGGCGTCATCCTGACGGCTATTTACTCGAGTAAATAGCCGTCAGGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-1001s21c1
Sequence:CCGGGCAGAGATTCATGGAGATGTACTCGAGTACATCTCCATGAATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020762.1-2161s1c1
Sequence:CCGGGCCCTGTTTATGAGAAATGTACTCGAGTACATTTCTCATAAACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-1541s1c1
Sequence:CCGGCCGCTCACAGTATAATACTAACTCGAGTTAGTATTATACTGTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-2571s1c1
Sequence:CCGGCGTCATCCTGACGGCTATTTACTCGAGTAAATAGCCGTCAGGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-1001s1c1
Sequence:CCGGGCAGAGATTCATGGAGATGTACTCGAGTACATCTCCATGAATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020762.1-225s1c1
Sequence:CCGGGCTGAAATTGAGACGGAATATCTCGAGATATTCCGTCTCAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020762
VALIDATED
SRGAP1 MISSION shRNA Lentiviral Transduction Particles
SLIT-ROBO Rho GTPase activating protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-3467s21c1
Sequence:CCGGGCTAAATTAACACGGGCATTTCTCGAGAAATGCCCGTGTTAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-2161s21c1
Sequence:CCGGGCCCTGTTTATGAGAAATGTACTCGAGTACATTTCTCATAAACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-225s21c1
Sequence:CCGGGCTGAAATTGAGACGGAATATCTCGAGATATTCCGTCTCAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-2571s21c1
Sequence:CCGGCGTCATCCTGACGGCTATTTACTCGAGTAAATAGCCGTCAGGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020762.2-1001s21c1
Sequence:CCGGGCAGAGATTCATGGAGATGTACTCGAGTACATCTCCATGAATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020762.1-2161s1c1
Sequence:CCGGGCCCTGTTTATGAGAAATGTACTCGAGTACATTTCTCATAAACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-1541s1c1
Sequence:CCGGCCGCTCACAGTATAATACTAACTCGAGTTAGTATTATACTGTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-2571s1c1
Sequence:CCGGCGTCATCCTGACGGCTATTTACTCGAGTAAATAGCCGTCAGGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020762.1-1001s1c1
Sequence:CCGGGCAGAGATTCATGGAGATGTACTCGAGTACATCTCCATGAATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020762.1-225s1c1
Sequence:CCGGGCTGAAATTGAGACGGAATATCTCGAGATATTCCGTCTCAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081037
SRGAP1 MISSION shRNA Bacterial Glycerol Stock
SLIT-ROBO Rho GTPase activating protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-1867s21c1
Sequence:CCGGTTGCCCAGGTCGGTCCTTATACTCGAGTATAAGGACCGACCTGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-2515s21c1
Sequence:CCGGCGCCATTCTGATAGCTATTTACTCGAGTAAATAGCTATCAGAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-401s21c1
Sequence:CCGGAGGACTCCACCCGGATGTTTACTCGAGTAAACATCCGGGTGGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-286s21c1
Sequence:CCGGCCAGTGAACTGCTGGTATTTGCTCGAGCAAATACCAGCAGTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-170s21c1
Sequence:CCGGCCGAAATTGAGACGGAATATTCTCGAGAATATTCCGTCTCAATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081037
SRGAP1 MISSION shRNA shRNA Plasmid DNA
SLIT-ROBO Rho GTPase activating protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-1867s21c1
Sequence:CCGGTTGCCCAGGTCGGTCCTTATACTCGAGTATAAGGACCGACCTGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-2515s21c1
Sequence:CCGGCGCCATTCTGATAGCTATTTACTCGAGTAAATAGCTATCAGAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-401s21c1
Sequence:CCGGAGGACTCCACCCGGATGTTTACTCGAGTAAACATCCGGGTGGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-286s21c1
Sequence:CCGGCCAGTGAACTGCTGGTATTTGCTCGAGCAAATACCAGCAGTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-170s21c1
Sequence:CCGGCCGAAATTGAGACGGAATATTCTCGAGAATATTCCGTCTCAATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081037
SRGAP1 MISSION shRNA Lentiviral Transduction Particles
SLIT-ROBO Rho GTPase activating protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-1867s21c1
Sequence:CCGGTTGCCCAGGTCGGTCCTTATACTCGAGTATAAGGACCGACCTGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-2515s21c1
Sequence:CCGGCGCCATTCTGATAGCTATTTACTCGAGTAAATAGCTATCAGAATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-401s21c1
Sequence:CCGGAGGACTCCACCCGGATGTTTACTCGAGTAAACATCCGGGTGGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-286s21c1
Sequence:CCGGCCAGTGAACTGCTGGTATTTGCTCGAGCAAATACCAGCAGTTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081037.1-170s21c1
Sequence:CCGGCCGAAATTGAGACGGAATATTCTCGAGAATATTCCGTCTCAATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)