SSBP2

single-stranded DNA binding protein 2

111 Gene Product Result for

Synonyms: HSPC116 SOSS-B2

Species: Human SSBP2(23635), Mouse Ssbp2(66970), Rat Ssbp2(361877), chicken SSBP2(770958), dog SSBP2(479160), domestic cat SSBP2(101088719), domestic guinea pig Ssbp2(100729506), naked mole-rat Ssbp2(101705238), cow SSBP2(616564), sheep SSBP2(101118446)

UniProtKB ID: P81877, B2R5W1, B7Z1J2, B7Z2L9, B7Z665, D6RH18, E9PB74, E9PDA8

Gene ID:

Human(23635) Summary: SSBP2 is a subunit of a single-stranded DNA (ssDNA)-binding complex involved in the maintenance of genome stability (Huang et al., 2009) [PubMed 19683501]

Mouse(66970) single-stranded DNA binding protein 2

Rat(361877) single-stranded DNA binding protein 2

chicken(770958) single-stranded DNA binding protein 2

dog(479160) single-stranded DNA binding protein 2

domestic cat(101088719) single-stranded DNA binding protein 2

domestic guinea pig(100729506) single-stranded DNA binding protein 2

naked mole-rat(101705238) single-stranded DNA binding protein 2

cow(616564) single-stranded DNA binding protein 2

sheep(101118446) single-stranded DNA binding protein 2

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB2501511	Anti-SSBP2 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution	canine, human, mouse, bovine	ELISA, western blot	pricing

SAB1407239	Anti-SSBP2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	immunofluorescence, western blot	pricing

SAB1409036	Anti-SSBP2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

SAB2107874	Anti-SSBP2 antibody produced in rabbit affinity isolated antibody	rabbit, rat, guinea pig, horse, mouse, bovine, human, dog	immunohistochemistry, western blot	pricing

HPA068605	Anti-SSBP2 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunofluorescence	pricing

AV31828	Anti-SSBP2 antibody produced in rabbit affinity isolated antibody, lyophilized powder	mouse, rat, canine, zebrafish, human, bovine	immunohistochemistry, western blot	pricing

SAB2102305	Anti-SSBP2 antibody produced in rabbit affinity isolated antibody	mouse, guinea pig, horse, rat, dog, human, rabbit, bovine	immunohistochemistry, western blot	pricing

SAB4501019	Anti-SSBP2 antibody produced in rabbit affinity isolated antibody	mouse, human	ELISA, immunohistochemistry, western blot	pricing

SAB1403159	Monoclonal Anti-SSBP2 antibody produced in mouse clone 2E7, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN20616	CompoZr^® Knockout ZFN Kit Human SSBP2 (NM_012446)	pricing

CKOZFN42078	CompoZr^® Knockout ZFN Kit Mouse Ssbp2 (NM_024186.5)	pricing

CKOZFND20616	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human SSBP2 (NM_012446)	pricing

CKOZFND42078	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Ssbp2 (NM_024186.5)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST94307	PrEST Antigen SSBP2 Prestige Antigens Powered by Atlas Antibodies	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR05896	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, SSBP2	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_012446	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_012446	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_012446	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_024272	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_024272	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_024272	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU050851	MISSION^® esiRNA esiRNA human SSBP2 (esiRNA1)	human	pricing

EMU000631	MISSION^® esiRNA esiRNA targeting mouse Ssbp2 (esiRNA1)	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_012446	Rosetta Predictions	human	pricing
XM_001065491	Rosetta Predictions	rat	pricing
XM_342171	Rosetta Predictions	rat	pricing
NM_024186	Rosetta Predictions	mouse	pricing
NM_024272	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_012446	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00052778 predicted	1375
2	SASI_Hs01_00052779 predicted	1158
3	SASI_Hs01_00052780 predicted	1170
4	SASI_Hs01_00052781 predicted	987
5	SASI_Hs01_00052782 predicted	1233
6	SASI_Hs01_00052784 predicted	731
7	SASI_Hs01_00052785 predicted	261
8	SASI_Hs01_00052786 predicted	450
9	SASI_Hs01_00052787 predicted	1277
10	SASI_Hs02_00344347 predicted	1343
11	SASI_Hs01_00052783 predicted	732

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_001065491	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00314340 predicted	1046
2	SASI_Rn02_00314341 predicted	1049
3	SASI_Rn02_00314342 predicted	194
4	SASI_Rn02_00314343 predicted	758
5	SASI_Rn02_00314344 predicted	887
6	SASI_Rn02_00314345 predicted	1275
7	SASI_Rn02_00314346 predicted	593
8	SASI_Rn02_00314347 predicted	578
9	SASI_Rn02_00314348 predicted	1136
10	SASI_Rn02_00314349 predicted	1165

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_342171	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00393853 predicted	1045
2	SASI_Rn02_00393854 predicted	1055
3	SASI_Rn02_00393855 predicted	193
4	SASI_Rn02_00393856 predicted	756
5	SASI_Rn02_00393857 predicted	884
6	SASI_Rn02_00393858 predicted	1278
7	SASI_Rn02_00393859 predicted	595
8	SASI_Rn02_00393860 predicted	579
9	SASI_Rn02_00393861 predicted	1131
10	SASI_Rn02_00393862 predicted	1159

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_024186	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00327509 predicted	1185
2	SASI_Mm02_00327510 predicted	954
3	SASI_Mm02_00327511 predicted	900
4	SASI_Mm01_00186869 predicted	620
5	SASI_Mm01_00186870 predicted	794
6	SASI_Mm02_00327512 predicted	946
7	SASI_Mm02_00327513 predicted	804
8	SASI_Mm02_00327514 predicted	1351
9	SASI_Mm02_00327515 predicted	1340
10	SASI_Mm02_00327516 predicted	790
11	SASI_Mm01_00186865 predicted	1410
12	SASI_Mm01_00186866 predicted	629
13	SASI_Mm01_00186867 predicted	1394
14	SASI_Mm01_00186868 predicted	672
15	SASI_Mm01_00186871 predicted	843
16	SASI_Mm01_00186872 predicted	807
17	SASI_Mm01_00186873 predicted	675
18	SASI_Mm01_00186874 predicted	831

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_024272	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00327675 predicted	1232
2	SASI_Mm02_00327676 predicted	994
3	SASI_Mm02_00327677 predicted	1000
4	SASI_Mm02_00327678 predicted	713
5	SASI_Mm02_00327679 predicted	936
6	SASI_Mm02_00327680 predicted	653
7	SASI_Mm01_00069676 predicted	835
8	SASI_Mm02_00327681 predicted	985
9	SASI_Mm02_00327682 predicted	1389
10	SASI_Mm02_00327683 predicted	1373
11	SASI_Mm01_00069672 predicted	1447
12	SASI_Mm01_00069673 predicted	666
13	SASI_Mm01_00069674 predicted	1432
14	SASI_Mm01_00069675 predicted	706
15	SASI_Mm01_00069677 predicted	883
16	SASI_Mm01_00069678 predicted	755
17	SASI_Mm01_00069679 predicted	869
18	SASI_Mm01_00069680 predicted	833
19	SASI_Mm01_00069681 predicted	843

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_012446 VALIDATED	SSBP2 MISSION shRNA Bacterial Glycerol Stock single-stranded DNA binding protein 2	Human

8 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000434769
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012446.2-1284s21c1
	Sequence:CCGGCAATGAGCGTGTGATCCATTACTCGAGTAATGGATCACACGCTCATTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000421389
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_012446.2-1483s21c1
	Sequence:CCGGACTGTACGGAGTGGCATATTACTCGAGTAATATGCCACTCCGTACAGTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000426580
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012446.2-1210s21c1
	Sequence:CCGGTCCAAGGGATGATGGCGAAATCTCGAGATTTCGCCATCATCCCTTGGATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016213
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-880s1c1
	Sequence:CCGGCCCAACAAATGCCAATTCAATCTCGAGATTGAATTGGCATTTGTTGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016215
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-695s1c1
	Sequence:CCGGCCAACTCGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGAGTTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016214
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-1164s1c1
	Sequence:CCGGCCAAGAATTCTCCCAATAATACTCGAGTATTATTGGGAGAATTCTTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016216
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-1118s1c1
	Sequence:CCGGCATCACATGAATGGCTCTTTACTCGAGTAAAGAGCCATTCATGTGATGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016217
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-435s1c1
	Sequence:CCGGCTCCAGAGAGACGTGAAACATCTCGAGATGTTTCACGTCTCTCTGGAGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_012446 VALIDATED	SSBP2 MISSION shRNA shRNA Plasmid DNA single-stranded DNA binding protein 2	Human

8 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000434769
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012446.2-1284s21c1
	Sequence:CCGGCAATGAGCGTGTGATCCATTACTCGAGTAATGGATCACACGCTCATTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000421389
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_012446.2-1483s21c1
	Sequence:CCGGACTGTACGGAGTGGCATATTACTCGAGTAATATGCCACTCCGTACAGTTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000426580
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012446.2-1210s21c1
	Sequence:CCGGTCCAAGGGATGATGGCGAAATCTCGAGATTTCGCCATCATCCCTTGGATTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016213
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-880s1c1
	Sequence:CCGGCCCAACAAATGCCAATTCAATCTCGAGATTGAATTGGCATTTGTTGGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016215
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-695s1c1
	Sequence:CCGGCCAACTCGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGAGTTGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016214
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-1164s1c1
	Sequence:CCGGCCAAGAATTCTCCCAATAATACTCGAGTATTATTGGGAGAATTCTTGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016216
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-1118s1c1
	Sequence:CCGGCATCACATGAATGGCTCTTTACTCGAGTAAAGAGCCATTCATGTGATGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016217
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-435s1c1
	Sequence:CCGGCTCCAGAGAGACGTGAAACATCTCGAGATGTTTCACGTCTCTCTGGAGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_012446 VALIDATED	SSBP2 MISSION shRNA Lentiviral Transduction Particles single-stranded DNA binding protein 2	Human

8 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000434769
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012446.2-1284s21c1
	Sequence:CCGGCAATGAGCGTGTGATCCATTACTCGAGTAATGGATCACACGCTCATTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000421389
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_012446.2-1483s21c1
	Sequence:CCGGACTGTACGGAGTGGCATATTACTCGAGTAATATGCCACTCCGTACAGTTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000426580
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012446.2-1210s21c1
	Sequence:CCGGTCCAAGGGATGATGGCGAAATCTCGAGATTTCGCCATCATCCCTTGGATTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016213
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-880s1c1
	Sequence:CCGGCCCAACAAATGCCAATTCAATCTCGAGATTGAATTGGCATTTGTTGGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016215
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-695s1c1
	Sequence:CCGGCCAACTCGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGAGTTGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016214
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-1164s1c1
	Sequence:CCGGCCAAGAATTCTCCCAATAATACTCGAGTATTATTGGGAGAATTCTTGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016216
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-1118s1c1
	Sequence:CCGGCATCACATGAATGGCTCTTTACTCGAGTAAAGAGCCATTCATGTGATGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000016217
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A3
	TRC Version: 1	Clone ID:NM_012446.2-435s1c1
	Sequence:CCGGCTCCAGAGAGACGTGAAACATCTCGAGATGTTTCACGTCTCTCTGGAGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_024272 VALIDATED	SSBP2 MISSION shRNA Bacterial Glycerol Stock single-stranded DNA binding protein 2	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000312905
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-746s21c1
	Sequence:CCGGTCAGCGTCTCCTGGGAATTACCTCGAGGTAATTCCCAGGAGACGCTGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311812
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-952s21c1
	Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000312945
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-1378s21c1
	Sequence:CCGGGGAAGAGAATGCATCGTATATCTCGAGATATACGATGCATTCTCTTCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108598
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-530s1c1
	Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000312859
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-108s21c1
	Sequence:CCGGAGTTAGCACTCTACGTGTATGCTCGAGCATACACGTAGAGTGCTAACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108597
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_024272.2-715s1c1
	Sequence:CCGGCCCAACAAATGCGAATTCAATCTCGAGATTGAATTCGCATTTGTTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108595
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.65	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-1352s1c1
	Sequence:CCGGGCGATGATTATCTGTGTGTATCTCGAGATACACACAGATAATCATCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108596
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-952s1c1
	Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108599
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-150s1c1
	Sequence:CCGGCTCAGAAATCGGCTCAGACATCTCGAGATGTCTGAGCCGATTTCTGAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311811
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-530s21c1
	Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_024272 VALIDATED	SSBP2 MISSION shRNA shRNA Plasmid DNA single-stranded DNA binding protein 2	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000312905
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-746s21c1
	Sequence:CCGGTCAGCGTCTCCTGGGAATTACCTCGAGGTAATTCCCAGGAGACGCTGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311812
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-952s21c1
	Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000312945
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-1378s21c1
	Sequence:CCGGGGAAGAGAATGCATCGTATATCTCGAGATATACGATGCATTCTCTTCCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108598
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-530s1c1
	Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000312859
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-108s21c1
	Sequence:CCGGAGTTAGCACTCTACGTGTATGCTCGAGCATACACGTAGAGTGCTAACTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108597
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_024272.2-715s1c1
	Sequence:CCGGCCCAACAAATGCGAATTCAATCTCGAGATTGAATTCGCATTTGTTGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108595
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.65	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-1352s1c1
	Sequence:CCGGGCGATGATTATCTGTGTGTATCTCGAGATACACACAGATAATCATCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108596
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-952s1c1
	Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108599
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-150s1c1
	Sequence:CCGGCTCAGAAATCGGCTCAGACATCTCGAGATGTCTGAGCCGATTTCTGAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311811
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-530s21c1
	Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_024272 VALIDATED	SSBP2 MISSION shRNA Lentiviral Transduction Particles single-stranded DNA binding protein 2	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000312905
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-746s21c1
	Sequence:CCGGTCAGCGTCTCCTGGGAATTACCTCGAGGTAATTCCCAGGAGACGCTGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311812
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-952s21c1
	Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000312945
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-1378s21c1
	Sequence:CCGGGGAAGAGAATGCATCGTATATCTCGAGATATACGATGCATTCTCTTCCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108598
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-530s1c1
	Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000312859
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-108s21c1
	Sequence:CCGGAGTTAGCACTCTACGTGTATGCTCGAGCATACACGTAGAGTGCTAACTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108597
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_024272.2-715s1c1
	Sequence:CCGGCCCAACAAATGCGAATTCAATCTCGAGATTGAATTCGCATTTGTTGGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108595
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.65	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-1352s1c1
	Sequence:CCGGGCGATGATTATCTGTGTGTATCTCGAGATACACACAGATAATCATCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108596
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-952s1c1
	Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000108599
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_024272.2-150s1c1
	Sequence:CCGGCTCAGAAATCGGCTCAGACATCTCGAGATGTCTGAGCCGATTTCTGAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311811
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_024272.3-530s21c1
	Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart