SSR2

signal sequence receptor, beta (translocon-associated protein beta)

96 Gene Product Result for

Synonyms: TLAP TRAP-BETA TRAPB

Species: Human SSR2(6746), Mouse Ssr2(66256), Rat Ssr2(295235), Zebrafish ssr2(83414), dog SSR2(403950), domestic cat SSR2(101085095), chicken SSR2(425656), naked mole-rat Ssr2(101702420), domestic guinea pig Ssr2(100719900), cow SSR2(506530), sheep SSR2(101122235)

UniProtKB ID: P43308, B2R9K9, D3DVA7, Q53HI0, Q5VY95, Q5VY96, Q6IB31, Q9BWE4

Gene ID:

Human(6746) Summary: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. [provided by RefSeq, Jul 2008]

Mouse(66256) signal sequence receptor, beta

Rat(295235) signal sequence receptor, beta

Zebrafish(83414) signal sequence receptor, beta

dog(403950) signal sequence receptor, beta (translocon-associated protein beta)

domestic cat(101085095) signal sequence receptor, beta (translocon-associated protein beta)

chicken(425656) signal sequence receptor, beta (translocon-associated protein beta)

naked mole-rat(101702420) signal sequence receptor, beta (translocon-associated protein beta)

domestic guinea pig(100719900) signal sequence receptor, beta (translocon-associated protein beta)

cow(506530) signal sequence receptor, beta (translocon-associated protein beta)

sheep(101122235) signal sequence receptor, beta (translocon-associated protein beta)

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB1401374	Anti-SSR2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	flow cytometry, western blot	pricing

AV45429	Anti-SSR2 antibody produced in rabbit IgG fraction of antiserum	human, guinea pig, horse, rat, dog, mouse, bovine	immunohistochemistry, western blot	pricing

HPA037787	Anti-SSR2 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

SAB2106709	Anti-SSR2 antibody produced in rabbit affinity isolated antibody	bovine, dog, mouse, human, rat, horse, rabbit, guinea pig	western blot	pricing

SAB1402930	Monoclonal Anti-SSR2 antibody produced in mouse clone 4C1, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN20628	CompoZr^® Knockout ZFN Kit Human SSR2 (NM_003145)	pricing

CKOZFN42089	CompoZr^® Knockout ZFN Kit Mouse Ssr2 (NM_025448.3)	pricing

CKOZFN63527	CompoZr^® Knockout ZFN Kit Rat Ssr2 (NM_001106442)	pricing

CKOZFND20628	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human SSR2 (NM_003145)	pricing

CKOZFND42089	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Ssr2 (NM_025448.3)	pricing

CKOZFND63527	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Ssr2 (NM_001106442)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST79651	PrEST Antigen SSR2 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST24062	SILu^™PrEST SSR2 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR05082	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, SSR2	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_003145	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_003145	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_003145	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_025448	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_025448	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_025448	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU154141	MISSION^® esiRNA esiRNA human SSR2 (esiRNA1)	human	pricing

EMU040341	MISSION^® esiRNA esiRNA targeting mouse Ssr2 (esiRNA1)	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_003145	Rosetta Predictions	human	pricing
NM_001106442	Rosetta Predictions	rat	pricing
NM_025448	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_003145	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00245082 predicted	768
2	SASI_Hs01_00245083 predicted	568
3	SASI_Hs01_00245084 predicted	591
4	SASI_Hs02_00335149 predicted	211
5	SASI_Hs02_00335150 predicted	819
6	SASI_Hs01_00245086 predicted	728
7	SASI_Hs01_00245087 predicted	231
8	SASI_Hs01_00245088 predicted	280
9	SASI_Hs01_00245089 predicted	351
10	SASI_Hs01_00245090 predicted	702
11	SASI_Hs01_00245085 predicted	407
12	SASI_Hs01_00245091 predicted	216

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001106442	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00218998 predicted	374
2	SASI_Rn02_00218999 predicted	314
3	SASI_Rn02_00219000 predicted	358
4	SASI_Rn02_00219001 predicted	228
5	SASI_Rn02_00219002 predicted	319
6	SASI_Rn02_00219003 predicted	316
7	SASI_Rn02_00219004 predicted	596
8	SASI_Rn02_00219005 predicted	362
9	SASI_Rn02_00219006 predicted	818
10	SASI_Rn02_00219007 predicted	233

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_025448	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00062245 predicted	217
2	SASI_Mm01_00062246 predicted	551
3	SASI_Mm01_00062247 predicted	666
4	SASI_Mm01_00062248 predicted	474
5	SASI_Mm01_00062249 predicted	466
6	SASI_Mm01_00062250 predicted	280
7	SASI_Mm01_00062251 predicted	718
8	SASI_Mm01_00062252 predicted	231
9	SASI_Mm01_00062253 predicted	456
10	SASI_Mm01_00062254 predicted	388

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_003145 VALIDATED	SSR2 MISSION shRNA Bacterial Glycerol Stock signal sequence receptor, beta (translocon-associated protein beta)	Human

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000299313
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-488s21c1
	Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063091
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-243s1c1
	Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063088
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-207s1c1
	Sequence:CCGGGCTGCATTAGACGTGGAACTACTCGAGTAGTTCCACGTCTAATGCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063089
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-338s1c1
	Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063090
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-567s1c1
	Sequence:CCGGAGGAAATATGACACTCCCAAACTCGAGTTTGGGAGTGTCATATTTCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063092
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-458s1c1
	Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000303600
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-391s21c1
	Sequence:CCGGACTTCACCTCGGCAACAATTACTCGAGTAATTGTTGCCGAGGTGAAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000303532
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-702s21c1
	Sequence:CCGGAGACTCCAAAGGGTATCTTAACTCGAGTTAAGATACCCTTTGGAGTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000299312
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-368s21c1
	Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000299311
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-273s21c1
	Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_003145 VALIDATED	SSR2 MISSION shRNA shRNA Plasmid DNA signal sequence receptor, beta (translocon-associated protein beta)	Human

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000299313
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-488s21c1
	Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063091
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-243s1c1
	Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063088
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-207s1c1
	Sequence:CCGGGCTGCATTAGACGTGGAACTACTCGAGTAGTTCCACGTCTAATGCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063089
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-338s1c1
	Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063090
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-567s1c1
	Sequence:CCGGAGGAAATATGACACTCCCAAACTCGAGTTTGGGAGTGTCATATTTCCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063092
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-458s1c1
	Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000303600
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-391s21c1
	Sequence:CCGGACTTCACCTCGGCAACAATTACTCGAGTAATTGTTGCCGAGGTGAAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000303532
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-702s21c1
	Sequence:CCGGAGACTCCAAAGGGTATCTTAACTCGAGTTAAGATACCCTTTGGAGTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000299312
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-368s21c1
	Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000299311
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-273s21c1
	Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_003145 VALIDATED	SSR2 MISSION shRNA Lentiviral Transduction Particles signal sequence receptor, beta (translocon-associated protein beta)	Human

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000299313
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-488s21c1
	Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063091
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-243s1c1
	Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063088
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-207s1c1
	Sequence:CCGGGCTGCATTAGACGTGGAACTACTCGAGTAGTTCCACGTCTAATGCAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063089
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-338s1c1
	Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063090
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-567s1c1
	Sequence:CCGGAGGAAATATGACACTCCCAAACTCGAGTTTGGGAGTGTCATATTTCCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000063092
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003145.2-458s1c1
	Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000303600
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-391s21c1
	Sequence:CCGGACTTCACCTCGGCAACAATTACTCGAGTAATTGTTGCCGAGGTGAAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000303532
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-702s21c1
	Sequence:CCGGAGACTCCAAAGGGTATCTTAACTCGAGTTAAGATACCCTTTGGAGTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000299312
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-368s21c1
	Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000299311
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003145.3-273s21c1
	Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_025448 VALIDATED	SSR2 MISSION shRNA Bacterial Glycerol Stock signal sequence receptor, beta (translocon-associated protein beta)	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000100710
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-930s1c1
	Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100712
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-368s1c1
	Sequence:CCGGCTGCATTAGATGTGGAATTATCTCGAGATAATTCCACATCTAATGCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100714
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-426s1c1
	Sequence:CCGGCTCCGGTATGCTCAATGTCAACTCGAGTTGACATTGAGCATACCGGAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100713
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-333s1c1
	Sequence:CCGGCCTGCAGTATAACATCTACAACTCGAGTTGTAGATGTTATACTGCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100711
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-365s1c1
	Sequence:CCGGGCGCTGCATTAGATGTGGAATCTCGAGATTCCACATCTAATGCAGCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306893
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-618s21c1
	Sequence:CCGGCGGGAGTTTGACAGGAGATTCCTCGAGGAATCTCCTGTCAAACTCCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294626
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-520s21c1
	Sequence:CCGGACTTCACTTCTGCCACGATTACTCGAGTAATCGTGGCAGAAGTGAAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000287187
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-929s21c1
	Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294561
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-487s21c1
	Sequence:CCGGTTGTCCTGCGTCCTCTCAAAGCTCGAGCTTTGAGAGGACGCAGGACAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294560
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-556s21c1
	Sequence:CCGGAGGATGGACCTGTTGTGATTGCTCGAGCAATCACAACAGGTCCATCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_025448 VALIDATED	SSR2 MISSION shRNA shRNA Plasmid DNA signal sequence receptor, beta (translocon-associated protein beta)	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000100710
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-930s1c1
	Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100712
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-368s1c1
	Sequence:CCGGCTGCATTAGATGTGGAATTATCTCGAGATAATTCCACATCTAATGCAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100714
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-426s1c1
	Sequence:CCGGCTCCGGTATGCTCAATGTCAACTCGAGTTGACATTGAGCATACCGGAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100713
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-333s1c1
	Sequence:CCGGCCTGCAGTATAACATCTACAACTCGAGTTGTAGATGTTATACTGCAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100711
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-365s1c1
	Sequence:CCGGGCGCTGCATTAGATGTGGAATCTCGAGATTCCACATCTAATGCAGCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306893
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-618s21c1
	Sequence:CCGGCGGGAGTTTGACAGGAGATTCCTCGAGGAATCTCCTGTCAAACTCCCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294626
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-520s21c1
	Sequence:CCGGACTTCACTTCTGCCACGATTACTCGAGTAATCGTGGCAGAAGTGAAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000287187
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-929s21c1
	Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294561
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-487s21c1
	Sequence:CCGGTTGTCCTGCGTCCTCTCAAAGCTCGAGCTTTGAGAGGACGCAGGACAATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294560
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-556s21c1
	Sequence:CCGGAGGATGGACCTGTTGTGATTGCTCGAGCAATCACAACAGGTCCATCCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_025448 VALIDATED	SSR2 MISSION shRNA Lentiviral Transduction Particles signal sequence receptor, beta (translocon-associated protein beta)	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000100710
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-930s1c1
	Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100712
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-368s1c1
	Sequence:CCGGCTGCATTAGATGTGGAATTATCTCGAGATAATTCCACATCTAATGCAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100714
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-426s1c1
	Sequence:CCGGCTCCGGTATGCTCAATGTCAACTCGAGTTGACATTGAGCATACCGGAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100713
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-333s1c1
	Sequence:CCGGCCTGCAGTATAACATCTACAACTCGAGTTGTAGATGTTATACTGCAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000100711
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_025448.2-365s1c1
	Sequence:CCGGGCGCTGCATTAGATGTGGAATCTCGAGATTCCACATCTAATGCAGCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306893
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-618s21c1
	Sequence:CCGGCGGGAGTTTGACAGGAGATTCCTCGAGGAATCTCCTGTCAAACTCCCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294626
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-520s21c1
	Sequence:CCGGACTTCACTTCTGCCACGATTACTCGAGTAATCGTGGCAGAAGTGAAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000287187
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-929s21c1
	Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294561
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-487s21c1
	Sequence:CCGGTTGTCCTGCGTCCTCTCAAAGCTCGAGCTTTGAGAGGACGCAGGACAATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294560
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_025448.3-556s21c1
	Sequence:CCGGAGGATGGACCTGTTGTGATTGCTCGAGCAATCACAACAGGTCCATCCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart