EMAIL THIS PAGE TO A FRIEND

SSX6

synovial sarcoma, X breakpoint 6 (pseudogene)

86 Gene Product Result for
Synonyms: SSXP2 dJ54B20.1 psiSSX2
Species: Human SSX6(280657)
UniProtKB ID: Q7RTT6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412942 Anti-SSX6 antibody produced in mouse purified immunoglobulin human
western blot pricing
SAB2102312 Anti-SSX6 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173357 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128391 MISSION® esiRNA esiRNA human SSX6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173357 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043062 predicted 550
2 SASI_Hs01_00043063 predicted 361
3 SASI_Hs01_00043064 predicted 352
4 SASI_Hs01_00043065 predicted 350
5 SASI_Hs01_00043066 predicted 355
6 SASI_Hs01_00043067 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173357
SSX6 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 6 (pseudogene)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173357.2-1062s1c1
Sequence:CCGGCTGAGTGTTTAATTTCCGATTCTCGAGAATCGGAAATTAAACACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-356s1c1
Sequence:CCGGCTCTCAGAGGAATGATTCTGACTCGAGTCAGAATCATTCCTCTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-554s1c1
Sequence:CCGGAGCAAGTAGCTCTGAGAAGATCTCGAGATCTTCTCAGAGCTACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173357.2-801s1c1
Sequence:CCGGGCAAGTGTTCACAACAGTGAACTCGAGTTCACTGTTGTGAACACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-352s1c2
Sequence:CCGGCAGACTCTCAGAGGAATGATTCTCGAGAATCATTCCTCTGAGAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-360s1c1
Sequence:CCGGCAGAGGAATGATTCTGATAATCTCGAGATTATCAGAATCATTCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173357
SSX6 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 6 (pseudogene)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173357.2-1062s1c1
Sequence:CCGGCTGAGTGTTTAATTTCCGATTCTCGAGAATCGGAAATTAAACACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-356s1c1
Sequence:CCGGCTCTCAGAGGAATGATTCTGACTCGAGTCAGAATCATTCCTCTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-554s1c1
Sequence:CCGGAGCAAGTAGCTCTGAGAAGATCTCGAGATCTTCTCAGAGCTACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173357.2-801s1c1
Sequence:CCGGGCAAGTGTTCACAACAGTGAACTCGAGTTCACTGTTGTGAACACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-352s1c2
Sequence:CCGGCAGACTCTCAGAGGAATGATTCTCGAGAATCATTCCTCTGAGAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-360s1c1
Sequence:CCGGCAGAGGAATGATTCTGATAATCTCGAGATTATCAGAATCATTCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173357
SSX6 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 6 (pseudogene)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173357.2-1062s1c1
Sequence:CCGGCTGAGTGTTTAATTTCCGATTCTCGAGAATCGGAAATTAAACACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-356s1c1
Sequence:CCGGCTCTCAGAGGAATGATTCTGACTCGAGTCAGAATCATTCCTCTGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-554s1c1
Sequence:CCGGAGCAAGTAGCTCTGAGAAGATCTCGAGATCTTCTCAGAGCTACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173357.2-801s1c1
Sequence:CCGGGCAAGTGTTCACAACAGTGAACTCGAGTTCACTGTTGTGAACACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-352s1c2
Sequence:CCGGCAGACTCTCAGAGGAATGATTCTCGAGAATCATTCCTCTGAGAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173357.2-360s1c1
Sequence:CCGGCAGAGGAATGATTCTGATAATCTCGAGATTATCAGAATCATTCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)