EMAIL THIS PAGE TO A FRIEND

ST6GALNAC2

ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2

46 Gene Product Result for
Synonyms: SAITL1 SIAT7 SIAT7B SIATL1 ST6GalNAII STHM
UniProtKB ID: Q9UJ37, Q12971
Gene ID:
Human(10610) Summary: ST6GALNAC2 belongs to a family of sialyltransferases that add sialic acids to the nonreducing ends of glycoconjugates. At the cell surface, these modifications have roles in cell-cell and cell-substrate interactions, bacterial adhesion, and protein targeting (Samyn-Petit et al., 2000 [PubMed 10742600]
Mouse(20446) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Rat(303692) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Zebrafish(100001225) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
dog(100049005) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
domestic cat(101098908) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
chicken(396159) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
naked mole-rat(101716098) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
domestic guinea pig(100725069) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
cow(511690) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
sheep(101103907) ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006456 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134231 MISSION® esiRNA esiRNA human ST6GALNAC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006456 Rosetta Predictions human pricing
NM_001031652 Rosetta Predictions rat pricing
NM_009180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025627 predicted 628
2 SASI_Hs01_00025628 predicted 533
3 SASI_Hs01_00025629 predicted 889
4 SASI_Hs01_00025630 predicted 1346
5 SASI_Hs01_00025631 predicted 203
6 SASI_Hs01_00025632 predicted 1373
7 SASI_Hs01_00025633 predicted 566
8 SASI_Hs01_00025634 predicted 905
9 SASI_Hs01_00025636 predicted 885
10 SASI_Hs02_00341599 predicted 1375
11 SASI_Hs01_00025635 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061192 predicted 426
2 SASI_Rn01_00061193 predicted 1054
3 SASI_Rn01_00061194 predicted 1017
4 SASI_Rn01_00061195 predicted 480
5 SASI_Rn01_00061196 predicted 596
6 SASI_Rn01_00061197 predicted 1032
7 SASI_Rn01_00061198 predicted 535
8 SASI_Rn01_00061200 predicted 802
9 SASI_Rn02_00203597 predicted 328
10 SASI_Rn01_00061201 predicted 974
11 SASI_Rn01_00061199 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124732 predicted 1082
2 SASI_Mm01_00124733 predicted 531
3 SASI_Mm01_00124734 predicted 1127
4 SASI_Mm01_00124735 predicted 522
5 SASI_Mm01_00124736 predicted 613
6 SASI_Mm01_00124738 predicted 900
7 SASI_Mm01_00124739 predicted 976
8 SASI_Mm01_00124740 predicted 662
9 SASI_Mm01_00124741 predicted 257
10 SASI_Mm02_00315548 predicted 705
11 SASI_Mm01_00124737 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009180
ST6GALNAC2 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009180.3-1331s21c1
Sequence:CCGGGAGACAAGACCCGTCACATAACTCGAGTTATGTGACGGGTCTTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-556s21c1
Sequence:CCGGGTGGTGGGTAACGGAGGTATTCTCGAGAATACCTCCGTTACCCACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-233s21c1
Sequence:CCGGCGTACCCACGAGCATTCTTTGCTCGAGCAAAGAATGCTCGTGGGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-617s21c1
Sequence:CCGGACTATGTCTTCAGACTCAATGCTCGAGCATTGAGTCTGAAGACATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009180.2-2859s1c1
Sequence:CCGGGCTCACTCATATACCCACAATCTCGAGATTGTGGGTATATGAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-920s1c1
Sequence:CCGGCCAAGCTGATTAACACACGATCTCGAGATCGTGTGTTAATCAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-357s1c1
Sequence:CCGGGAATAATCTGAGCCAGCACAACTCGAGTTGTGCTGGCTCAGATTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-1080s1c1
Sequence:CCGGACCACTGATATTCTACGCAAACTCGAGTTTGCGTAGAATATCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-845s1c1
Sequence:CCGGCGGAAACCTCTGCCAGTAAATCTCGAGATTTACTGGCAGAGGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009180
ST6GALNAC2 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009180.3-1331s21c1
Sequence:CCGGGAGACAAGACCCGTCACATAACTCGAGTTATGTGACGGGTCTTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-556s21c1
Sequence:CCGGGTGGTGGGTAACGGAGGTATTCTCGAGAATACCTCCGTTACCCACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-233s21c1
Sequence:CCGGCGTACCCACGAGCATTCTTTGCTCGAGCAAAGAATGCTCGTGGGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-617s21c1
Sequence:CCGGACTATGTCTTCAGACTCAATGCTCGAGCATTGAGTCTGAAGACATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009180.2-2859s1c1
Sequence:CCGGGCTCACTCATATACCCACAATCTCGAGATTGTGGGTATATGAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-920s1c1
Sequence:CCGGCCAAGCTGATTAACACACGATCTCGAGATCGTGTGTTAATCAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-357s1c1
Sequence:CCGGGAATAATCTGAGCCAGCACAACTCGAGTTGTGCTGGCTCAGATTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-1080s1c1
Sequence:CCGGACCACTGATATTCTACGCAAACTCGAGTTTGCGTAGAATATCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-845s1c1
Sequence:CCGGCGGAAACCTCTGCCAGTAAATCTCGAGATTTACTGGCAGAGGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009180
ST6GALNAC2 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009180.3-1331s21c1
Sequence:CCGGGAGACAAGACCCGTCACATAACTCGAGTTATGTGACGGGTCTTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-556s21c1
Sequence:CCGGGTGGTGGGTAACGGAGGTATTCTCGAGAATACCTCCGTTACCCACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-233s21c1
Sequence:CCGGCGTACCCACGAGCATTCTTTGCTCGAGCAAAGAATGCTCGTGGGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009180.3-617s21c1
Sequence:CCGGACTATGTCTTCAGACTCAATGCTCGAGCATTGAGTCTGAAGACATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009180.2-2859s1c1
Sequence:CCGGGCTCACTCATATACCCACAATCTCGAGATTGTGGGTATATGAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-920s1c1
Sequence:CCGGCCAAGCTGATTAACACACGATCTCGAGATCGTGTGTTAATCAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-357s1c1
Sequence:CCGGGAATAATCTGAGCCAGCACAACTCGAGTTGTGCTGGCTCAGATTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-1080s1c1
Sequence:CCGGACCACTGATATTCTACGCAAACTCGAGTTTGCGTAGAATATCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009180.2-845s1c1
Sequence:CCGGCGGAAACCTCTGCCAGTAAATCTCGAGATTTACTGGCAGAGGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006456
ST6GALNAC2 MISSION shRNA Bacterial Glycerol Stock
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1631s21c1
Sequence:CCGGGATTGGCACTGAGCAACTTTACTCGAGTAAAGTTGCTCAGTGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1514s21c1
Sequence:CCGGCATCGAGGTCTGTTCAATATACTCGAGTATATTGAACAGACCTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1816s21c1
Sequence:CCGGGCTTACTTCTGCTCCATAATACTCGAGTATTATGGAGCAGAAGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-844s1c1
Sequence:CCGGGCCAGTAAATTCAAGCTGCTACTCGAGTAGCAGCTTGAATTTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-885s1c1
Sequence:CCGGCCTGACAGAAAGGTTCTTGAACTCGAGTTCAAGAACCTTTCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-1041s1c1
Sequence:CCGGCGACCACTATTTCGAACGAAACTCGAGTTTCGTTCGAAATAGTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-743s1c1
Sequence:CCGGGCGACTATGTGATGCTGAGATCTCGAGATCTCAGCATCACATAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-185s1c1
Sequence:CCGGCATTCTTTCAATCCAAGGCATCTCGAGATGCCTTGGATTGAAAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006456
ST6GALNAC2 MISSION shRNA shRNA Plasmid DNA
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1631s21c1
Sequence:CCGGGATTGGCACTGAGCAACTTTACTCGAGTAAAGTTGCTCAGTGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1514s21c1
Sequence:CCGGCATCGAGGTCTGTTCAATATACTCGAGTATATTGAACAGACCTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1816s21c1
Sequence:CCGGGCTTACTTCTGCTCCATAATACTCGAGTATTATGGAGCAGAAGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-844s1c1
Sequence:CCGGGCCAGTAAATTCAAGCTGCTACTCGAGTAGCAGCTTGAATTTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-885s1c1
Sequence:CCGGCCTGACAGAAAGGTTCTTGAACTCGAGTTCAAGAACCTTTCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-1041s1c1
Sequence:CCGGCGACCACTATTTCGAACGAAACTCGAGTTTCGTTCGAAATAGTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-743s1c1
Sequence:CCGGGCGACTATGTGATGCTGAGATCTCGAGATCTCAGCATCACATAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-185s1c1
Sequence:CCGGCATTCTTTCAATCCAAGGCATCTCGAGATGCCTTGGATTGAAAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006456
ST6GALNAC2 MISSION shRNA Lentiviral Transduction Particles
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1631s21c1
Sequence:CCGGGATTGGCACTGAGCAACTTTACTCGAGTAAAGTTGCTCAGTGCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1514s21c1
Sequence:CCGGCATCGAGGTCTGTTCAATATACTCGAGTATATTGAACAGACCTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006456.2-1816s21c1
Sequence:CCGGGCTTACTTCTGCTCCATAATACTCGAGTATTATGGAGCAGAAGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-844s1c1
Sequence:CCGGGCCAGTAAATTCAAGCTGCTACTCGAGTAGCAGCTTGAATTTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-885s1c1
Sequence:CCGGCCTGACAGAAAGGTTCTTGAACTCGAGTTCAAGAACCTTTCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-1041s1c1
Sequence:CCGGCGACCACTATTTCGAACGAAACTCGAGTTTCGTTCGAAATAGTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-743s1c1
Sequence:CCGGGCGACTATGTGATGCTGAGATCTCGAGATCTCAGCATCACATAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006456.1-185s1c1
Sequence:CCGGCATTCTTTCAATCCAAGGCATCTCGAGATGCCTTGGATTGAAAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)