EMAIL THIS PAGE TO A FRIEND

STAG3L2

stromal antigen 3-like 2 (pseudogene)

14 Gene Product Result for
Synonyms: STAG3L1 STAG3L2P STAG3L3
Species: Human STAG3L2(442582)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025202 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147411 MISSION® esiRNA esiRNA human STAG3L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025202 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015457 predicted 655
2 SASI_Hs01_00015458 predicted 654
3 SASI_Hs01_00015459 predicted 564
4 SASI_Hs01_00015460 predicted 776
5 SASI_Hs01_00015461 predicted 648
6 SASI_Hs01_00015456 predicted 649
7 SASI_Hs01_00015455 predicted 798
8 SASI_Hs01_00015462 predicted 1047
9 SASI_Hs01_00015463 predicted 1012
10 SASI_Hs01_00015464 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025202
VALIDATED
STAG3L2 MISSION shRNA Bacterial Glycerol Stock
stromal antigen 3-like 2 (pseudogene)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000172776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-462s1c1
Sequence:CCGGGCTTCAAGGACTGGATGGTTTCTCGAGAAACCATCCAGTCCTTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001025202.1-935s1c1
Sequence:CCGGGAGAGATTGCTTGCTTCACTTCTCGAGAAGTGAAGCAAGCAATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-784s1c1
Sequence:CCGGCGCTGCTTACTTAGTAGACAACTCGAGTTGTCTACTAAGTAAGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-641s1c1
Sequence:CCGGGAATTTCTGTACTGGAAACTTCTCGAGAAGTTTCCAGTACAGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025202
VALIDATED
STAG3L2 MISSION shRNA shRNA Plasmid DNA
stromal antigen 3-like 2 (pseudogene)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000172776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-462s1c1
Sequence:CCGGGCTTCAAGGACTGGATGGTTTCTCGAGAAACCATCCAGTCCTTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001025202.1-935s1c1
Sequence:CCGGGAGAGATTGCTTGCTTCACTTCTCGAGAAGTGAAGCAAGCAATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-784s1c1
Sequence:CCGGCGCTGCTTACTTAGTAGACAACTCGAGTTGTCTACTAAGTAAGCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-641s1c1
Sequence:CCGGGAATTTCTGTACTGGAAACTTCTCGAGAAGTTTCCAGTACAGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025202
VALIDATED
STAG3L2 MISSION shRNA Lentiviral Transduction Particles
stromal antigen 3-like 2 (pseudogene)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000172776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-462s1c1
Sequence:CCGGGCTTCAAGGACTGGATGGTTTCTCGAGAAACCATCCAGTCCTTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001025202.1-935s1c1
Sequence:CCGGGAGAGATTGCTTGCTTCACTTCTCGAGAAGTGAAGCAAGCAATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-784s1c1
Sequence:CCGGCGCTGCTTACTTAGTAGACAACTCGAGTTGTCTACTAAGTAAGCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025202.1-641s1c1
Sequence:CCGGGAATTTCTGTACTGGAAACTTCTCGAGAAGTTTCCAGTACAGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)