STAM2

signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

126 Gene Product Result for

Synonyms: Hbp STAM2A STAM2B

Species: Human STAM2(10254), Mouse Stam2(56324), Rat Stam2(311030), Zebrafish stam2(492497), chicken STAM2(424317), Horse STAM2(100057966), domestic cat STAM2(101080562), dog STAM2(476150), naked mole-rat Stam2(101722782), Domestic Rabbit STAM2(100351322), domestic guinea pig Stam2(100727167), cow STAM2(538505), sheep STAM2(101117649)

UniProtKB ID: O75886, A8K8A0, D3DPA1, Q7LDQ0, Q9UF58

Gene ID:

Human(10254) Summary: The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation. [provided by RefSeq, Jul 2008]

Mouse(56324) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

Rat(311030) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

Zebrafish(492497) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

chicken(424317) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

Horse(100057966) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

domestic cat(101080562) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

dog(476150) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

naked mole-rat(101722782) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

Domestic Rabbit(100351322) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

domestic guinea pig(100727167) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

cow(538505) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

sheep(101117649) signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB4504320	Anti-phospho-STAM2 (pTyr¹⁹²) antibody produced in rabbit affinity isolated antibody	mouse, human, rat	ELISA, western blot	pricing

SAB1105067	Anti-STAM2 (181-195) antibody produced in rabbit IgG fraction of antiserum	human	western blot	pricing

SAB1105068	Anti-STAM2 (371-383) antibody produced in rabbit IgG fraction of antiserum	human	western blot	pricing

SAB2500991	Anti-STAM2 antibody produced in goat affinity isolated antibody, buffered aqueous solution	human, canine, mouse	ELISA, western blot	pricing

HPA035528	Anti-STAM2 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

HPA035529	Anti-STAM2 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB4503519	Anti-STAM2 antibody produced in rabbit affinity isolated antibody	human, mouse	ELISA, immunofluorescence, western blot	pricing

SAB1410076	Anti-STAM2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

WH0010254M1	Monoclonal Anti-STAM2 antibody produced in mouse clone 1A10, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunoprecipitation (IP), western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN20693	CompoZr^® Knockout ZFN Kit Human STAM2 (NM_005843)	pricing

CKOZFN42148	CompoZr^® Knockout ZFN Kit Mouse Stam2 (NM_019667.2)	pricing

CKOZFN63568	CompoZr^® Knockout ZFN Kit Rat Stam2 (NM_001012085)	pricing

CKOZFND20693	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human STAM2 (NM_005843)	pricing

CKOZFND42148	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Stam2 (NM_019667.2)	pricing

CKOZFND63568	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Stam2 (NM_001012085)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST78964	PrEST Antigen STAM2 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST78965	PrEST Antigen STAM2 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR10922	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, STAM2	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_005843	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_005843	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_005843	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_019667	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_019667	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_019667	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU004541	MISSION^® esiRNA esiRNA targeting human STAM2 (esiRNA1)	human	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_005843	Rosetta Predictions	human	pricing
NM_001012085	Rosetta Predictions	rat	pricing
XM_575133	Rosetta Predictions	rat	pricing
NM_019667	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_005843	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00138144 predicted	1522
2	SASI_Hs01_00138147 predicted	1448
3	SASI_Hs02_00340382 predicted	915
4	SASI_Hs01_00138148 predicted	439
5	SASI_Hs01_00138150 predicted	461
6	SASI_Hs01_00138151 predicted	1826
7	SASI_Hs01_00138152 predicted	1682
8	SASI_Hs02_00340383 predicted	1791
9	SASI_Hs01_00138153 predicted	1260
10	SASI_Hs02_00340384 predicted	723
11	SASI_Hs01_00138145 predicted	1364
12	SASI_Hs01_00138146 predicted	962
13	SASI_Hs01_00138149 predicted	737

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001012085	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00200215 predicted	327
2	SASI_Rn01_00036376 predicted	863
3	SASI_Rn01_00036377 predicted	268
4	SASI_Rn01_00036378 predicted	716
5	SASI_Rn01_00036379 predicted	910
6	SASI_Rn01_00036380 predicted	767
7	SASI_Rn01_00036381 predicted	970
8	SASI_Rn01_00036382 predicted	484
9	SASI_Rn01_00036383 predicted	914
10	SASI_Rn01_00036384 predicted	280
11	SASI_Rn01_00036385 predicted	335

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_575133	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00163010 predicted	1767
2	SASI_Rn01_00163011 predicted	1808
3	SASI_Rn01_00163012 predicted	1778
4	SASI_Rn01_00163013 predicted	1914
5	SASI_Rn01_00163014 predicted	1903
6	SASI_Rn01_00163015 predicted	1934
7	SASI_Rn01_00163016 predicted	1832
8	SASI_Rn01_00163017 predicted	1866
9	SASI_Rn01_00163018 predicted	1774
10	SASI_Rn01_00163019 predicted	1939

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_019667	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00094963 predicted	943
2	SASI_Mm01_00094964 predicted	1340
3	SASI_Mm02_00324730 predicted	1320
4	SASI_Mm01_00094965 predicted	275
5	SASI_Mm01_00094966 predicted	1002
6	SASI_Mm01_00094967 predicted	543
7	SASI_Mm01_00094968 predicted	436
8	SASI_Mm01_00094969 predicted	1148
9	SASI_Mm01_00094970 predicted	428
10	SASI_Mm01_00094971 predicted	1303
11	SASI_Mm01_00094972 predicted	217

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_005843 VALIDATED	STAM2 MISSION shRNA Bacterial Glycerol Stock signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	Human

6 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000056774
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005843.3-1699s1c1
	Sequence:CCGGGCACTGGACAAGACACTGTTTCTCGAGAAACAGTGTCTTGTCCAGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056773
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-960s1c1
	Sequence:CCGGGCACGGAAAGTGAGAGCTTTACTCGAGTAAAGCTCTCACTTTCCGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056777
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-1676s1c1
	Sequence:CCGGGCCTGCTCAAACTTCATATTTCTCGAGAAATATGAAGTTTGAGCAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056775
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-1452s1c1
	Sequence:CCGGGCACCAGTGTACTCAGTCTATCTCGAGATAGACTGAGTACACTGGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056776
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-415s1c1
	Sequence:CCGGCTACAGAAGATTGGAGTCTTACTCGAGTAAGACTCCAATCTTCTGTAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380808
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCH58
	TRC Version: 2	Clone ID:NM_005843.4-624s21c1
	Sequence:GTACCGGGAAGTACGTGCTGTGATTAAACTCGAGTTTAATCACAGCACGTACTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_005843 VALIDATED	STAM2 MISSION shRNA shRNA Plasmid DNA signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	Human

6 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000056774
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005843.3-1699s1c1
	Sequence:CCGGGCACTGGACAAGACACTGTTTCTCGAGAAACAGTGTCTTGTCCAGTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056773
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-960s1c1
	Sequence:CCGGGCACGGAAAGTGAGAGCTTTACTCGAGTAAAGCTCTCACTTTCCGTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056777
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-1676s1c1
	Sequence:CCGGGCCTGCTCAAACTTCATATTTCTCGAGAAATATGAAGTTTGAGCAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056775
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-1452s1c1
	Sequence:CCGGGCACCAGTGTACTCAGTCTATCTCGAGATAGACTGAGTACACTGGTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056776
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-415s1c1
	Sequence:CCGGCTACAGAAGATTGGAGTCTTACTCGAGTAAGACTCCAATCTTCTGTAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380808
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCH58
	TRC Version: 2	Clone ID:NM_005843.4-624s21c1
	Sequence:GTACCGGGAAGTACGTGCTGTGATTAAACTCGAGTTTAATCACAGCACGTACTTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_005843 VALIDATED	STAM2 MISSION shRNA Lentiviral Transduction Particles signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	Human

6 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000056774
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005843.3-1699s1c1
	Sequence:CCGGGCACTGGACAAGACACTGTTTCTCGAGAAACAGTGTCTTGTCCAGTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056773
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-960s1c1
	Sequence:CCGGGCACGGAAAGTGAGAGCTTTACTCGAGTAAAGCTCTCACTTTCCGTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056777
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-1676s1c1
	Sequence:CCGGGCCTGCTCAAACTTCATATTTCTCGAGAAATATGAAGTTTGAGCAGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056775
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-1452s1c1
	Sequence:CCGGGCACCAGTGTACTCAGTCTATCTCGAGATAGACTGAGTACACTGGTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000056776
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: MCH58
	TRC Version: 1	Clone ID:NM_005843.3-415s1c1
	Sequence:CCGGCTACAGAAGATTGGAGTCTTACTCGAGTAAGACTCCAATCTTCTGTAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380808
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCH58
	TRC Version: 2	Clone ID:NM_005843.4-624s21c1
	Sequence:GTACCGGGAAGTACGTGCTGTGATTAAACTCGAGTTTAATCACAGCACGTACTTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_019667 VALIDATED	STAM2 MISSION shRNA Bacterial Glycerol Stock signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000326630
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-668s21c1
	Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065581
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019667.2-668s1c1
	Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-852s1c1
	Sequence:CCGGCGGTGGACAAATTGAATGTAACTCGAGTTACATTCAATTTGTCCACCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065580
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019667.2-1371s1c1
	Sequence:CCGGCCGTCCAACCTCCATACTTAACTCGAGTTAAGTATGGAGGTTGGACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065582
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-1151s1c1
	Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065579
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-321s1c1
	Sequence:CCGGCGGAAGTACGTTCTGTGATAACTCGAGTTATCACAGAACGTACTTCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306339
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-428s21c1
	Sequence:CCGGAGTCTGATATCTGCAACTATTCTCGAGAATAGTTGCAGATATCAGACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306340
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-295s21c1
	Sequence:CCGGAGAAGTATGTTCCCGTGATTTCTCGAGAAATCACGGGAACATACTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326705
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-1151s21c1
	Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306338
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_019667.2-2066s21c1
	Sequence:CCGGTTTAGCTTGCCAGCATATTTCCTCGAGGAAATATGCTGGCAAGCTAAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_019667 VALIDATED	STAM2 MISSION shRNA shRNA Plasmid DNA signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000326630
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-668s21c1
	Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065581
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019667.2-668s1c1
	Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-852s1c1
	Sequence:CCGGCGGTGGACAAATTGAATGTAACTCGAGTTACATTCAATTTGTCCACCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065580
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019667.2-1371s1c1
	Sequence:CCGGCCGTCCAACCTCCATACTTAACTCGAGTTAAGTATGGAGGTTGGACGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065582
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-1151s1c1
	Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065579
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-321s1c1
	Sequence:CCGGCGGAAGTACGTTCTGTGATAACTCGAGTTATCACAGAACGTACTTCCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306339
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-428s21c1
	Sequence:CCGGAGTCTGATATCTGCAACTATTCTCGAGAATAGTTGCAGATATCAGACTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306340
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-295s21c1
	Sequence:CCGGAGAAGTATGTTCCCGTGATTTCTCGAGAAATCACGGGAACATACTTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326705
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-1151s21c1
	Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306338
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_019667.2-2066s21c1
	Sequence:CCGGTTTAGCTTGCCAGCATATTTCCTCGAGGAAATATGCTGGCAAGCTAAATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_019667 VALIDATED	STAM2 MISSION shRNA Lentiviral Transduction Particles signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000326630
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-668s21c1
	Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065581
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019667.2-668s1c1
	Sequence:CCGGGTCAGAGCTTTATACGACTTTCTCGAGAAAGTCGTATAAAGCTCTGACTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065578
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-852s1c1
	Sequence:CCGGCGGTGGACAAATTGAATGTAACTCGAGTTACATTCAATTTGTCCACCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065580
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019667.2-1371s1c1
	Sequence:CCGGCCGTCCAACCTCCATACTTAACTCGAGTTAAGTATGGAGGTTGGACGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065582
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-1151s1c1
	Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065579
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019667.2-321s1c1
	Sequence:CCGGCGGAAGTACGTTCTGTGATAACTCGAGTTATCACAGAACGTACTTCCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306339
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-428s21c1
	Sequence:CCGGAGTCTGATATCTGCAACTATTCTCGAGAATAGTTGCAGATATCAGACTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306340
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-295s21c1
	Sequence:CCGGAGAAGTATGTTCCCGTGATTTCTCGAGAAATCACGGGAACATACTTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326705
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019667.2-1151s21c1
	Sequence:CCGGGCGCCTGTGTACTCGGTCTATCTCGAGATAGACCGAGTACACAGGCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306338
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_019667.2-2066s21c1
	Sequence:CCGGTTTAGCTTGCCAGCATATTTCCTCGAGGAAATATGCTGGCAAGCTAAATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart