STC2

stanniocalcin 2

195 Gene Product Result for

Synonyms: STC-2 STCRP

Species: Human STC2(8614), Mouse Stc2(20856), Rat Stc2(63878), chicken STC2(416208), domestic cat STC2(101090485), dog STC2(489112), cow STC2(540573), sheep STC2(101109910), naked mole-rat Stc2(101723645), domestic guinea pig Stc2(100727509)

UniProtKB ID: O76061

Gene ID:

Human(8614) Summary: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]

Mouse(20856) stanniocalcin 2

Rat(63878) stanniocalcin 2

chicken(416208) stanniocalcin 2

domestic cat(101090485) stanniocalcin 2

dog(489112) stanniocalcin 2

cow(540573) stanniocalcin 2

sheep(101109910) stanniocalcin 2

naked mole-rat(101723645) stanniocalcin 2

domestic guinea pig(100727509) stanniocalcin 2

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

GW22017	Anti-ATC2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution	human	western blot	pricing

HPA045372	Anti-STC2 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB1409924	Monoclonal Anti-STC-2 antibody produced in mouse clone 4D9, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409925	Monoclonal Anti-STC-2 antibody produced in mouse clone 4B3, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409926	Monoclonal Anti-STC-2 antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409927	Monoclonal Anti-STC-2 antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409928	Monoclonal Anti-STC-2 antibody produced in mouse clone 2A9, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409929	Monoclonal Anti-STC-2 antibody produced in mouse clone 4B9, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409930	Monoclonal Anti-STC-2 antibody produced in mouse clone 1F5, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409931	Monoclonal Anti-STC-2 antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409932	Monoclonal Anti-STC-2 antibody produced in mouse clone 2G3, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409933	Monoclonal Anti-STC-2 antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409934	Monoclonal Anti-STC-2 antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409935	Monoclonal Anti-STC-2 antibody produced in mouse clone 3E2, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409936	Monoclonal Anti-STC-2 antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409937	Monoclonal Anti-STC-2 antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409938	Monoclonal Anti-STC-2 antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409939	Monoclonal Anti-STC-2 antibody produced in mouse clone 4B7, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

SAB1409940	Monoclonal Anti-STC-2 antibody produced in mouse clone 4C2, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

WH0008614M8	Monoclonal Anti-STC2 antibody produced in mouse clone 2B11, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST84439	PrEST Antigen STC2 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST21925	SILu^™PrEST STC2 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR13880	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, STC2	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_003714	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_003714	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_003714	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_011491	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_011491	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_011491	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU029291	MISSION^® esiRNA targeting human STC2	human	pricing

EMU051181	MISSION^® esiRNA targeting mouse Stc2	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_003714	Rosetta Predictions	human	pricing
NM_022230	Rosetta Predictions	rat	pricing
NM_011491	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_003714	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00025657 predicted	1546
2	SASI_Hs01_00025660 predicted	2448
3	SASI_Hs01_00025661 predicted	2185
4	SASI_Hs01_00025662 predicted	2413
5	SASI_Hs01_00025663 predicted	1810
6	SASI_Hs01_00025664 predicted	2335
7	SASI_Hs01_00025666 predicted	2065
8	SASI_Hs02_00336137 predicted	2459
9	SASI_Hs02_00336138 predicted	1506
10	SASI_Hs02_00336139 predicted	1757
11	SASI_Hs01_00025658 predicted	1506
12	SASI_Hs01_00025659 predicted	1527
13	SASI_Hs01_00025665 predicted	1459

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_022230	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00262995 predicted	209
2	SASI_Rn01_00041754 predicted	222
3	SASI_Rn01_00041755 predicted	467
4	SASI_Rn01_00041756 predicted	389
5	SASI_Rn01_00041757 predicted	249
6	SASI_Rn01_00041758 predicted	386
7	SASI_Rn01_00041759 predicted	249
8	SASI_Rn01_00041761 predicted	253
9	SASI_Rn01_00041762 predicted	216
10	SASI_Rn02_00262996 predicted	383
11	SASI_Rn01_00041760 predicted	517
12	SASI_Rn01_00041763 predicted	241

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_011491	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00126689 predicted	1324
2	SASI_Mm01_00126690 predicted	393
3	SASI_Mm01_00126691 predicted	428
4	SASI_Mm01_00126693 predicted	1349
5	SASI_Mm02_00320786 predicted	652
6	SASI_Mm02_00320787 predicted	575
7	SASI_Mm01_00126694 predicted	418
8	SASI_Mm01_00126695 predicted	1051
9	SASI_Mm01_00126696 predicted	1099
10	SASI_Mm01_00126697 predicted	701
11	SASI_Mm01_00126692 predicted	412
12	SASI_Mm01_00126698 predicted	540

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_003714 VALIDATED	STC2 MISSION shRNA Bacterial Glycerol Stock stanniocalcin 2	Human

17 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000331040
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003714.2-2244s21c1
	Sequence:CCGGTTTCCTCCACGCCGTCCATTTCTCGAGAAATGGACGGCGTGGAGGAAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000331041
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1820s21c1
	Sequence:CCGGCTACGTGGACCTCGTGAACTTCTCGAGAAGTTCACGAGGTCCACGTAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000330980
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1603s21c1
	Sequence:CCGGAGGGCAAGTCATTCATCAAAGCTCGAGCTTTGATGAATGACTTGCCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000145344
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-348s1c1
	Sequence:CCGGGAGAACAACTCTTGTGAGATTCTCGAGAATCTCACAAGAGTTGTTCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000144973
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-599s1c1
	Sequence:CCGGGATAGTGGAGATGATCCATTTCTCGAGAAATGGATCATCTCCACTATCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000141456
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-426s1c1
	Sequence:CCGGCAGGGCAAGTCATTCATCAAACTCGAGTTTGATGAATGACTTGCCCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000141305
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-347s1c1
	Sequence:CCGGCGAGAACAACTCTTGTGAGATCTCGAGATCTCACAAGAGTTGTTCTCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000142455
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-1005s1c1
	Sequence:CCGGGAAGACGAACAGTCTGAGTATCTCGAGATACTCAGACTGTTCGTCTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000145325
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003714.1-608s1c1
	Sequence:CCGGGATGATCCATTTCAAGGACTTCTCGAGAAGTCCTTGAAATGGATCATCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000145343
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-339s1c1
	Sequence:CCGGGAATGTTTCGAGAACAACTCTCTCGAGAGAGTTGTTCTCGAAACATTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000331039
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-2187s21c1
	Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000331042
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1776s21c1
	Sequence:CCGGATAGTGGAGATGATCCATTTCCTCGAGGAAATGGATCATCTCCACTATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000139795
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-425s1c1
	Sequence:CCGGCCAGGGCAAGTCATTCATCAACTCGAGTTGATGAATGACTTGCCCTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000144102
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-332s1c1
	Sequence:CCGGCGTGTTTGAATGTTTCGAGAACTCGAGTTCTCGAAACATTCAAACACGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000144949
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003714.1-1011s1c1
	Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000142236
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-434s1c1
	Sequence:CCGGGTCATTCATCAAAGACGCCTTCTCGAGAAGGCGTCTTTGATGAATGACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000144818
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_003714.2-4789s1c1
	Sequence:CCGGGCAAGCATTGATTGAGACATTCTCGAGAATGTCTCAATCAATGCTTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_003714 VALIDATED	STC2 MISSION shRNA shRNA Plasmid DNA stanniocalcin 2	Human

17 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000331040
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003714.2-2244s21c1
	Sequence:CCGGTTTCCTCCACGCCGTCCATTTCTCGAGAAATGGACGGCGTGGAGGAAATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000331041
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1820s21c1
	Sequence:CCGGCTACGTGGACCTCGTGAACTTCTCGAGAAGTTCACGAGGTCCACGTAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000330980
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1603s21c1
	Sequence:CCGGAGGGCAAGTCATTCATCAAAGCTCGAGCTTTGATGAATGACTTGCCCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000145344
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-348s1c1
	Sequence:CCGGGAGAACAACTCTTGTGAGATTCTCGAGAATCTCACAAGAGTTGTTCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000144973
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-599s1c1
	Sequence:CCGGGATAGTGGAGATGATCCATTTCTCGAGAAATGGATCATCTCCACTATCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000141456
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-426s1c1
	Sequence:CCGGCAGGGCAAGTCATTCATCAAACTCGAGTTTGATGAATGACTTGCCCTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000141305
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-347s1c1
	Sequence:CCGGCGAGAACAACTCTTGTGAGATCTCGAGATCTCACAAGAGTTGTTCTCGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000142455
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-1005s1c1
	Sequence:CCGGGAAGACGAACAGTCTGAGTATCTCGAGATACTCAGACTGTTCGTCTTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000145325
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003714.1-608s1c1
	Sequence:CCGGGATGATCCATTTCAAGGACTTCTCGAGAAGTCCTTGAAATGGATCATCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000145343
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-339s1c1
	Sequence:CCGGGAATGTTTCGAGAACAACTCTCTCGAGAGAGTTGTTCTCGAAACATTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000331039
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-2187s21c1
	Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000331042
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1776s21c1
	Sequence:CCGGATAGTGGAGATGATCCATTTCCTCGAGGAAATGGATCATCTCCACTATTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000139795
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-425s1c1
	Sequence:CCGGCCAGGGCAAGTCATTCATCAACTCGAGTTGATGAATGACTTGCCCTGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000144102
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-332s1c1
	Sequence:CCGGCGTGTTTGAATGTTTCGAGAACTCGAGTTCTCGAAACATTCAAACACGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000144949
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003714.1-1011s1c1
	Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000142236
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-434s1c1
	Sequence:CCGGGTCATTCATCAAAGACGCCTTCTCGAGAAGGCGTCTTTGATGAATGACTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000144818
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_003714.2-4789s1c1
	Sequence:CCGGGCAAGCATTGATTGAGACATTCTCGAGAATGTCTCAATCAATGCTTGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_003714 VALIDATED	STC2 MISSION shRNA Lentiviral Transduction Particles stanniocalcin 2	Human

17 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000331040
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003714.2-2244s21c1
	Sequence:CCGGTTTCCTCCACGCCGTCCATTTCTCGAGAAATGGACGGCGTGGAGGAAATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000331041
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1820s21c1
	Sequence:CCGGCTACGTGGACCTCGTGAACTTCTCGAGAAGTTCACGAGGTCCACGTAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000330980
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1603s21c1
	Sequence:CCGGAGGGCAAGTCATTCATCAAAGCTCGAGCTTTGATGAATGACTTGCCCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000145344
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-348s1c1
	Sequence:CCGGGAGAACAACTCTTGTGAGATTCTCGAGAATCTCACAAGAGTTGTTCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000144973
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-599s1c1
	Sequence:CCGGGATAGTGGAGATGATCCATTTCTCGAGAAATGGATCATCTCCACTATCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000141456
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-426s1c1
	Sequence:CCGGCAGGGCAAGTCATTCATCAAACTCGAGTTTGATGAATGACTTGCCCTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000141305
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-347s1c1
	Sequence:CCGGCGAGAACAACTCTTGTGAGATCTCGAGATCTCACAAGAGTTGTTCTCGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000142455
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-1005s1c1
	Sequence:CCGGGAAGACGAACAGTCTGAGTATCTCGAGATACTCAGACTGTTCGTCTTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000145325
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003714.1-608s1c1
	Sequence:CCGGGATGATCCATTTCAAGGACTTCTCGAGAAGTCCTTGAAATGGATCATCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000145343
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-339s1c1
	Sequence:CCGGGAATGTTTCGAGAACAACTCTCTCGAGAGAGTTGTTCTCGAAACATTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000331039
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-2187s21c1
	Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000331042
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_003714.2-1776s21c1
	Sequence:CCGGATAGTGGAGATGATCCATTTCCTCGAGGAAATGGATCATCTCCACTATTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000139795
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-425s1c1
	Sequence:CCGGCCAGGGCAAGTCATTCATCAACTCGAGTTGATGAATGACTTGCCCTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000144102
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-332s1c1
	Sequence:CCGGCGTGTTTGAATGTTTCGAGAACTCGAGTTCTCGAAACATTCAAACACGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000144949
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003714.1-1011s1c1
	Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000142236
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003714.1-434s1c1
	Sequence:CCGGGTCATTCATCAAAGACGCCTTCTCGAGAAGGCGTCTTTGATGAATGACTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000144818
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_003714.2-4789s1c1
	Sequence:CCGGGCAAGCATTGATTGAGACATTCTCGAGAATGTCTCAATCAATGCTTGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_011491	STC2 MISSION shRNA Bacterial Glycerol Stock stanniocalcin 2	Mouse

5 Products Total

TRC Number
We do not support the configuration options you have chosen
TRCN0000109913
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-564s1c1
	Sequence:CCGGGCAGGAAGTGTCCAGCAATTACTCGAGTAATTGCTGGACACTTCCTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000109910
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_011491.3-1562s1c1
	Sequence:CCGGCGGAAGTTTAGTGTCGTGCATCTCGAGATGCACGACACTAAACTTCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000109912
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-658s1c1
	Sequence:CCGGCGGTGTGATTGTGGAGATGATCTCGAGATCATCTCCACAATCACACCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000109914
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-411s1c1
	Sequence:CCGGTCGAGAACAACTCTTGTGAAACTCGAGTTTCACAAGAGTTGTTCTCGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000109911
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-412s1c1
	Sequence:CCGGCGAGAACAACTCTTGTGAAATCTCGAGATTTCACAAGAGTTGTTCTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_011491	STC2 MISSION shRNA shRNA Plasmid DNA stanniocalcin 2	Mouse

5 Products Total

TRC Number		Vector
We do not support the configuration options you have chosen
TRCN0000109913
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-564s1c1
	Sequence:CCGGGCAGGAAGTGTCCAGCAATTACTCGAGTAATTGCTGGACACTTCCTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000109910
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_011491.3-1562s1c1
	Sequence:CCGGCGGAAGTTTAGTGTCGTGCATCTCGAGATGCACGACACTAAACTTCCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000109912
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-658s1c1
	Sequence:CCGGCGGTGTGATTGTGGAGATGATCTCGAGATCATCTCCACAATCACACCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000109914
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-411s1c1
	Sequence:CCGGTCGAGAACAACTCTTGTGAAACTCGAGTTTCACAAGAGTTGTTCTCGATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000109911
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-412s1c1
	Sequence:CCGGCGAGAACAACTCTTGTGAAATCTCGAGATTTCACAAGAGTTGTTCTCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_011491	STC2 MISSION shRNA Lentiviral Transduction Particles stanniocalcin 2	Mouse

5 Products Total

TRC Number	Volume	Vector
We do not support the configuration options you have chosen
TRCN0000109913
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-564s1c1
	Sequence:CCGGGCAGGAAGTGTCCAGCAATTACTCGAGTAATTGCTGGACACTTCCTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000109910
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_011491.3-1562s1c1
	Sequence:CCGGCGGAAGTTTAGTGTCGTGCATCTCGAGATGCACGACACTAAACTTCCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000109912
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-658s1c1
	Sequence:CCGGCGGTGTGATTGTGGAGATGATCTCGAGATCATCTCCACAATCACACCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000109914
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-411s1c1
	Sequence:CCGGTCGAGAACAACTCTTGTGAAACTCGAGTTTCACAAGAGTTGTTCTCGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000109911
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_011491.3-412s1c1
	Sequence:CCGGCGAGAACAACTCTTGTGAAATCTCGAGATTTCACAAGAGTTGTTCTCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart