STEAP1

six transmembrane epithelial antigen of the prostate 1

52 Gene Product Result for

Synonyms: PRSS24 STEAP

Species: Human STEAP1(26872), Mouse Steap1(70358), Rat Steap1(297738), chicken STEAP1(420540), domestic cat STEAP1(101080700), dog STEAP1(475222), domestic guinea pig Steap1(100714140), naked mole-rat Steap1(101702977), Domestic Rabbit STEAP1(100328630), cow STEAP1(515156), sheep STEAP1(101111709)

UniProtKB ID: Q9UHE8, A4D1E0, O95034

Gene ID:

Human(26872) Summary: This gene is predominantly expressed in prostate tissue, and is found to be upregulated in multiple cancer cell lines. The gene product is predicted to be a six-transmembrane protein, and was shown to be a cell surface antigen significantly expressed at cell-cell junctions. [provided by RefSeq, Jul 2008]

Mouse(70358) six transmembrane epithelial antigen of the prostate 1

Rat(297738) six transmembrane epithelial antigen of the prostate 1

chicken(420540) six transmembrane epithelial antigen of the prostate 1

domestic cat(101080700) six transmembrane epithelial antigen of the prostate 1

dog(475222) six transmembrane epithelial antigen of the prostate 1

domestic guinea pig(100714140) six transmembrane epithelial antigen of the prostate 1

naked mole-rat(101702977) six transmembrane epithelial antigen of the prostate 1

Domestic Rabbit(100328630) six transmembrane epithelial antigen of the prostate 1

cow(515156) six transmembrane epithelial antigen of the prostate 1

sheep(101111709) six transmembrane epithelial antigen of the prostate 1

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

PRS4303	Anti-STEAP1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human, mouse, rat	ELISA, immunohistochemistry, western blot	pricing

PRS4305	Anti-STEAP1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human, mouse, rat	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

HPA030985	Anti-STEAP1 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

SAB1405026	Monoclonal Anti-STEAP1 antibody produced in mouse clone 4F6-1F3, ascites fluid	human	ELISA, western blot	pricing

WH0026872M1	Monoclonal Anti-STEAP1 antibody produced in mouse clone 4F6-1F3, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST88504	PrEST Antigen STEAP1 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_027399	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_027399	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_027399	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_012449	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_012449	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_012449	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU108771	MISSION^® esiRNA targeting human STEAP1	human	pricing

EHU111401	MISSION^® esiRNA targeting human STEAP1B	human	pricing

EMU024021	MISSION^® esiRNA targeting mouse Steap1	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_012449	Rosetta Predictions	human	pricing
NM_001106629	Rosetta Predictions	rat	pricing
NM_027399	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_012449	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00154411 predicted	989
2	SASI_Hs02_00344353 predicted	483
3	SASI_Hs01_00154412 predicted	1090
4	SASI_Hs01_00154413 predicted	977
5	SASI_Hs02_00344354 predicted	603
6	SASI_Hs02_00344355 predicted	566
7	SASI_Hs01_00154415 predicted	784
8	SASI_Hs01_00154416 predicted	646
9	SASI_Hs02_00344356 predicted	543
10	SASI_Hs01_00154418 predicted	655
11	SASI_Hs01_00154414 predicted	1020
12	SASI_Hs01_00154417 predicted	933
13	SASI_Hs01_00154419 predicted	1093
14	SASI_Hs01_00154420 predicted	1021

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001106629	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00220828 predicted	949
2	SASI_Rn02_00220829 predicted	364
3	SASI_Rn02_00220830 predicted	858
4	SASI_Rn02_00220831 predicted	551
5	SASI_Rn02_00220832 predicted	347
6	SASI_Rn02_00220833 predicted	906
7	SASI_Rn02_00220834 predicted	694
8	SASI_Rn02_00220835 predicted	935
9	SASI_Rn02_00220836 predicted	294
10	SASI_Rn02_00220837 predicted	495

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_027399	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00153159 predicted	352
2	SASI_Mm01_00153160 predicted	836
3	SASI_Mm01_00153161 predicted	451
4	SASI_Mm01_00153162 predicted	923
5	SASI_Mm01_00153163 predicted	370
6	SASI_Mm01_00153164 predicted	445
7	SASI_Mm01_00153165 predicted	663
8	SASI_Mm01_00153166 predicted	702
9	SASI_Mm01_00153167 predicted	530
10	SASI_Mm02_00332122 predicted	365
11	SASI_Mm01_00153168 predicted	423

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_027399 VALIDATED	STEAP1 MISSION shRNA Bacterial Glycerol Stock six transmembrane epithelial antigen of the prostate 1	Mouse

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000288053
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-429s21c1
	Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125734
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-914s1c1
	Sequence:CCGGGCCTGGAATAAATGGGTAGATCTCGAGATCTACCCATTTATTCCAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125736
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-834s1c1
	Sequence:CCGGCCTGGAGAGAATTTCACTATACTCGAGTATAGTGAAATTCTCTCCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125737
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-833s1c1
	Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125735
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-430s1c1
	Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125738
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-333s1c1
	Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288052
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-332s21c1
	Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288130
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_027399.2-832s21c1
	Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295393
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-469s21c1
	Sequence:CCGGCTCTTGGCACTGGTCTATTTGCTCGAGCAAATAGACCAGTGCCAAGAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_027399 VALIDATED	STEAP1 MISSION shRNA shRNA Plasmid DNA six transmembrane epithelial antigen of the prostate 1	Mouse

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000288053
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-429s21c1
	Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000125734
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-914s1c1
	Sequence:CCGGGCCTGGAATAAATGGGTAGATCTCGAGATCTACCCATTTATTCCAGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000125736
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-834s1c1
	Sequence:CCGGCCTGGAGAGAATTTCACTATACTCGAGTATAGTGAAATTCTCTCCAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000125737
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-833s1c1
	Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000125735
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-430s1c1
	Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000125738
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-333s1c1
	Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000288052
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-332s21c1
	Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000288130
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_027399.2-832s21c1
	Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000295393
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-469s21c1
	Sequence:CCGGCTCTTGGCACTGGTCTATTTGCTCGAGCAAATAGACCAGTGCCAAGAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_027399 VALIDATED	STEAP1 MISSION shRNA Lentiviral Transduction Particles six transmembrane epithelial antigen of the prostate 1	Mouse

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000288053
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-429s21c1
	Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125734
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-914s1c1
	Sequence:CCGGGCCTGGAATAAATGGGTAGATCTCGAGATCTACCCATTTATTCCAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125736
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-834s1c1
	Sequence:CCGGCCTGGAGAGAATTTCACTATACTCGAGTATAGTGAAATTCTCTCCAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125737
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-833s1c1
	Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125735
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-430s1c1
	Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000125738
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_027399.1-333s1c1
	Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288052
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-332s21c1
	Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288130
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_027399.2-832s21c1
	Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295393
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_027399.2-469s21c1
	Sequence:CCGGCTCTTGGCACTGGTCTATTTGCTCGAGCAAATAGACCAGTGCCAAGAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_012449 VALIDATED	STEAP1 MISSION shRNA Bacterial Glycerol Stock six transmembrane epithelial antigen of the prostate 1	Human

14 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000281237
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-609s21c1
	Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000297943
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012449.2-354s21c1
	Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000162020
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-1017s1c1
	Sequence:CCGGGCCTGGAATAAGTGGATAGATCTCGAGATCTATCCACTTATTCCAGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000161064
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-473s1c1
	Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158850
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-994s1c1
	Sequence:CCGGGCACAATACACGCATTGATTTCTCGAGAAATCAATGCGTGTATTGTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158955
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-267s1c1
	Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159419
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-609s1c1
	Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159569
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_012449.2-617s1c1
	Sequence:CCGGCCAACTTCATAATGGAACCAACTCGAGTTGGTTCCATTATGAAGTTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000160657
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_012449.2-1019s1c1
	Sequence:CCGGCTGGAATAAGTGGATAGATATCTCGAGATATCTATCCACTTATTCCAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000161811
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-820s1c1
	Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000164986
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-354s1c1
	Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000281236
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-473s21c1
	Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000281175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-820s21c1
	Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000281169
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-267s21c1
	Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_012449 VALIDATED	STEAP1 MISSION shRNA shRNA Plasmid DNA six transmembrane epithelial antigen of the prostate 1	Human

14 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000281237
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-609s21c1
	Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000297943
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012449.2-354s21c1
	Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000162020
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-1017s1c1
	Sequence:CCGGGCCTGGAATAAGTGGATAGATCTCGAGATCTATCCACTTATTCCAGGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000161064
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-473s1c1
	Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000158850
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-994s1c1
	Sequence:CCGGGCACAATACACGCATTGATTTCTCGAGAAATCAATGCGTGTATTGTGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000158955
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-267s1c1
	Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000159419
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-609s1c1
	Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000159569
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_012449.2-617s1c1
	Sequence:CCGGCCAACTTCATAATGGAACCAACTCGAGTTGGTTCCATTATGAAGTTGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000160657
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_012449.2-1019s1c1
	Sequence:CCGGCTGGAATAAGTGGATAGATATCTCGAGATATCTATCCACTTATTCCAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000161811
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-820s1c1
	Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000164986
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-354s1c1
	Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000281236
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-473s21c1
	Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000281175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-820s21c1
	Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000281169
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-267s21c1
	Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_012449 VALIDATED	STEAP1 MISSION shRNA Lentiviral Transduction Particles six transmembrane epithelial antigen of the prostate 1	Human

14 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000281237
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-609s21c1
	Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000297943
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_012449.2-354s21c1
	Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000162020
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-1017s1c1
	Sequence:CCGGGCCTGGAATAAGTGGATAGATCTCGAGATCTATCCACTTATTCCAGGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000161064
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-473s1c1
	Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158850
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-994s1c1
	Sequence:CCGGGCACAATACACGCATTGATTTCTCGAGAAATCAATGCGTGTATTGTGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158955
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-267s1c1
	Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159419
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-609s1c1
	Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159569
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_012449.2-617s1c1
	Sequence:CCGGCCAACTTCATAATGGAACCAACTCGAGTTGGTTCCATTATGAAGTTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000160657
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_012449.2-1019s1c1
	Sequence:CCGGCTGGAATAAGTGGATAGATATCTCGAGATATCTATCCACTTATTCCAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000161811
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-820s1c1
	Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000164986
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_012449.2-354s1c1
	Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000281236
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-473s21c1
	Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000281175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-820s21c1
	Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000281169
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 2	Clone ID:NM_012449.2-267s21c1
	Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart