STK38L

serine/threonine kinase 38 like

248 Gene Product Result for

Synonyms: NDR2

Species: Human STK38L(23012), Mouse Stk38l(232533), Rat Stk38l(691337), Zebrafish stk38l(393957), domestic cat STK38L(101081905), dog STK38L(477663), chicken STK38L(418217), cow STK38L(514787), sheep STK38L(101111789), naked mole-rat Stk38l(101706716)

UniProtKB ID: Q9Y2H1, A8K4U0, Q8TBX7

Gene ID:

Human(23012)

Mouse(232533) serine/threonine kinase 38 like

Rat(691337) serine/threonine kinase 38 like

Zebrafish(393957) serine/threonine kinase 38 like

domestic cat(101081905) serine/threonine kinase 38 like

dog(477663) serine/threonine kinase 38 like

chicken(418217) serine/threonine kinase 38 like

cow(514787) serine/threonine kinase 38 like

sheep(101111789) serine/threonine kinase 38 like

naked mole-rat(101706716) serine/threonine kinase 38 like

Gene Class: Cytoskeleton

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB1302065	ANTI-MOUSE STK38L (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	mouse	western blot	pricing

S5448	Anti-STK38L (421-435) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	western blot	pricing

SAB1300424	Anti-STK38L (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	ELISA, western blot	pricing

SAB1300423	Anti-STK38L (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	ELISA, western blot	pricing

SAB1407165	Anti-STK38L antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

HPA038623	Anti-STK38L antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

HPA051324	Anti-STK38L antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunofluorescence	pricing

SAB1402547	Monoclonal Anti-STK38L antibody produced in mouse clone 4E5, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunohistochemistry, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN20744	CompoZr^® Knockout ZFN Kit Human STK38L (NM_015000)	pricing

CKOZFN42205	CompoZr^® Knockout ZFN Kit Mouse Stk38l (NM_172734.3)	pricing

CKOZFN63621	CompoZr^® Knockout ZFN Kit Rat Stk38l (NM_001083336)	pricing

CKOZFND20744	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human STK38L (NM_015000)	pricing

CKOZFND42205	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Stk38l (NM_172734.3)	pricing

CKOZFND63621	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Stk38l (NM_001083336)	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP5236	NDR2, active, GST tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

APREST89639	PrEST Antigen STK38L Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST78864	PrEST Antigen STK38L Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST39139	SILu^™PrEST ST38L SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_015000	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_015000	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_015000	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_172734	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_172734	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_172734	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU227141	MISSION^® esiRNA esiRNA targeting human STK38L	human	pricing

EMU046591	MISSION^® esiRNA esiRNA targeting mouse Stk38l (esiRNA1)	mouse	pricing

siRNA Nano Scale

Product #	Description	Species	Add to Cart

SIHK2193	MISSION^® siRNA Human Kinase STK38L (siRNA2), Nano Scale 0.25 nmol	human	pricing

SIHK2192	MISSION^® siRNA Human Kinase STK38L (siRNA1), Nano Scale 0.25 nmol	human	pricing

SIHK2194	MISSION^® siRNA Human Kinase STK38L (siRNA3), Nano Scale 0.25 nmol	human	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_015000	Rosetta Predictions	human	pricing
NM_001083336	Rosetta Predictions	rat	pricing
NM_172734	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_015000	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00346769 predicted	1093
2	SASI_Hs01_00074233 predicted	1208
3	SASI_Hs01_00074234 predicted	638
4	SASI_Hs01_00074235 predicted	529
5	SASI_Hs01_00074236 predicted	923
6	SASI_Hs01_00074237 predicted	927
7	SASI_Hs01_00074238 predicted	1194
8	SASI_Hs01_00074239 predicted	1505
9	SASI_Hs01_00074240 predicted	681
10	SASI_Hs01_00074241 predicted	1434
11	SASI_Hs01_00074242 predicted	398

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001083336	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00208859 predicted	1360
2	SASI_Rn02_00208860 predicted	1076
3	SASI_Rn02_00208861 predicted	682
4	SASI_Rn02_00208862 predicted	1329
5	SASI_Rn02_00208863 predicted	753
6	SASI_Rn02_00208864 predicted	544
7	SASI_Rn02_00208865 predicted	894
8	SASI_Rn02_00208866 predicted	666
9	SASI_Rn02_00208867 predicted	1128
10	SASI_Rn02_00208868 predicted	1098

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_172734	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00344546 predicted	418
2	SASI_Mm01_00174282 predicted	1258
3	SASI_Mm02_00344547 predicted	680
4	SASI_Mm01_00174288 predicted	1191
5	SASI_Mm01_00174289 predicted	286
6	SASI_Mm02_00344548 predicted	445
7	SASI_Mm02_00344549 predicted	1336
8	SASI_Mm02_00344550 predicted	1240
9	SASI_Mm02_00344551 predicted	266
10	SASI_Mm02_00344552 predicted	430
11	SASI_Mm01_00174280 predicted	906
12	SASI_Mm01_00174281 predicted	977
13	SASI_Mm01_00174283 predicted	534
14	SASI_Mm01_00174284 predicted	788
15	SASI_Mm01_00174285 predicted	692
16	SASI_Mm01_00174286 predicted	521
17	SASI_Mm01_00174287 predicted	584

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_015000 VALIDATED	STK38L MISSION shRNA Bacterial Glycerol Stock serine/threonine kinase 38 like	Human

14 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000196904
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-1061s1c1
	Sequence:CCGGGCAGACTGGTTACAACAAATTCTCGAGAATTTGTTGTAACCAGTCTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195441
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-1450s1c1
	Sequence:CCGGCCACAGAACCGGACTACAAATCTCGAGATTTGTAGTCCGGTTCTGTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196612
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-796s1c1
	Sequence:CCGGGTTTCATCCATCGGGATATTACTCGAGTAATATCCCGATGGATGAAACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002053
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_015000.x-336s1c1
	Sequence:CCGGGAAGAAGGATTAGCAGATGAACTCGAGTTCATCTGCTAATCCTTCTTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002054
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_015000.x-496s1c1
	Sequence:CCGGAGAAGAAAGATACAGGCCATACTCGAGTATGGCCTGTATCTTTCTTCTTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002057
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_015000.x-3788s1c1
	Sequence:CCGGCCCTGGAGTTAATAGAGTGATCTCGAGATCACTCTATTAACTCCAGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002056
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_015000.x-1099s1c1
	Sequence:CCGGTGGGAGTGATTATGTATGAAACTCGAGTTTCATACATAATCACTCCCATTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002055
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_015000.x-1356s1c1
	Sequence:CCGGCCAGCAGCAATCCCTATAGAACTCGAGTTCTATAGGGATTGCTGCTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000355732
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.86	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-1647s21c1
	Sequence:CCGGGGCTTGCTTGGCGTAGATAACCTCGAGGTTATCTACGCCAAGCAAGCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320812
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-603s21c1
	Sequence:CCGGTCCGAGCAGAAAGAGATATTTCTCGAGAAATATCTCTTTCTGCTCGGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320888
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_015000.3-821s21c1
	Sequence:CCGGGGTTTCATCCATCGGGATATTCTCGAGAATATCCCGATGGATGAAACCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320877
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_015000.3-1866s21c1
	Sequence:CCGGACTGCCTACATGCGTATTAAGCTCGAGCTTAATACGCATGTAGGCAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000350288
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-1353s21c1
	Sequence:CCGGGTGTCGACTGGGAGCACATAACTCGAGTTATGTGCTCCCAGTCGACACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000355733
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-894s21c1
	Sequence:CCGGTTGGTTTATGTACGGGATTAACTCGAGTTAATCCCGTACATAAACCAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_015000 VALIDATED	STK38L MISSION shRNA shRNA Plasmid DNA serine/threonine kinase 38 like	Human

14 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000196904
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-1061s1c1
	Sequence:CCGGGCAGACTGGTTACAACAAATTCTCGAGAATTTGTTGTAACCAGTCTGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195441
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-1450s1c1
	Sequence:CCGGCCACAGAACCGGACTACAAATCTCGAGATTTGTAGTCCGGTTCTGTGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196612
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-796s1c1
	Sequence:CCGGGTTTCATCCATCGGGATATTACTCGAGTAATATCCCGATGGATGAAACTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002053
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_015000.x-336s1c1
	Sequence:CCGGGAAGAAGGATTAGCAGATGAACTCGAGTTCATCTGCTAATCCTTCTTCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002054
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_015000.x-496s1c1
	Sequence:CCGGAGAAGAAAGATACAGGCCATACTCGAGTATGGCCTGTATCTTTCTTCTTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002057
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_015000.x-3788s1c1
	Sequence:CCGGCCCTGGAGTTAATAGAGTGATCTCGAGATCACTCTATTAACTCCAGGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002056
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_015000.x-1099s1c1
	Sequence:CCGGTGGGAGTGATTATGTATGAAACTCGAGTTTCATACATAATCACTCCCATTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002055
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_015000.x-1356s1c1
	Sequence:CCGGCCAGCAGCAATCCCTATAGAACTCGAGTTCTATAGGGATTGCTGCTGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000355732
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.86	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-1647s21c1
	Sequence:CCGGGGCTTGCTTGGCGTAGATAACCTCGAGGTTATCTACGCCAAGCAAGCCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320812
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-603s21c1
	Sequence:CCGGTCCGAGCAGAAAGAGATATTTCTCGAGAAATATCTCTTTCTGCTCGGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320888
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_015000.3-821s21c1
	Sequence:CCGGGGTTTCATCCATCGGGATATTCTCGAGAATATCCCGATGGATGAAACCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320877
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_015000.3-1866s21c1
	Sequence:CCGGACTGCCTACATGCGTATTAAGCTCGAGCTTAATACGCATGTAGGCAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000350288
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-1353s21c1
	Sequence:CCGGGTGTCGACTGGGAGCACATAACTCGAGTTATGTGCTCCCAGTCGACACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000355733
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-894s21c1
	Sequence:CCGGTTGGTTTATGTACGGGATTAACTCGAGTTAATCCCGTACATAAACCAATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_015000 VALIDATED	STK38L MISSION shRNA Lentiviral Transduction Particles serine/threonine kinase 38 like	Human

14 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000196904
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-1061s1c1
	Sequence:CCGGGCAGACTGGTTACAACAAATTCTCGAGAATTTGTTGTAACCAGTCTGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195441
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-1450s1c1
	Sequence:CCGGCCACAGAACCGGACTACAAATCTCGAGATTTGTAGTCCGGTTCTGTGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196612
Product Details	Region:CDS
	TRC Version: 1.5	Clone ID:NM_015000.1-796s1c1
	Sequence:CCGGGTTTCATCCATCGGGATATTACTCGAGTAATATCCCGATGGATGAAACTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002053
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_015000.x-336s1c1
	Sequence:CCGGGAAGAAGGATTAGCAGATGAACTCGAGTTCATCTGCTAATCCTTCTTCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002054
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_015000.x-496s1c1
	Sequence:CCGGAGAAGAAAGATACAGGCCATACTCGAGTATGGCCTGTATCTTTCTTCTTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002057
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_015000.x-3788s1c1
	Sequence:CCGGCCCTGGAGTTAATAGAGTGATCTCGAGATCACTCTATTAACTCCAGGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002056
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_015000.x-1099s1c1
	Sequence:CCGGTGGGAGTGATTATGTATGAAACTCGAGTTTCATACATAATCACTCCCATTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002055
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_015000.x-1356s1c1
	Sequence:CCGGCCAGCAGCAATCCCTATAGAACTCGAGTTCTATAGGGATTGCTGCTGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000355732
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.86	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-1647s21c1
	Sequence:CCGGGGCTTGCTTGGCGTAGATAACCTCGAGGTTATCTACGCCAAGCAAGCCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320812
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-603s21c1
	Sequence:CCGGTCCGAGCAGAAAGAGATATTTCTCGAGAAATATCTCTTTCTGCTCGGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320888
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_015000.3-821s21c1
	Sequence:CCGGGGTTTCATCCATCGGGATATTCTCGAGAATATCCCGATGGATGAAACCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320877
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_015000.3-1866s21c1
	Sequence:CCGGACTGCCTACATGCGTATTAAGCTCGAGCTTAATACGCATGTAGGCAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000350288
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-1353s21c1
	Sequence:CCGGGTGTCGACTGGGAGCACATAACTCGAGTTATGTGCTCCCAGTCGACACTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000355733
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_015000.3-894s21c1
	Sequence:CCGGTTGGTTTATGTACGGGATTAACTCGAGTTAATCCCGTACATAAACCAATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_172734 VALIDATED	STK38L MISSION shRNA Bacterial Glycerol Stock serine/threonine kinase 38 like	Mouse

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000022910
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_172734.2-1246s1c1
	Sequence:CCGGCCTATAGAAATCCGGAGTATACTCGAGTATACTCCGGATTTCTATAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022911
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-1189s1c1
	Sequence:CCGGCATCCGTTCTTTGAGGGTGTACTCGAGTACACCCTCAAAGAACGGATGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022912
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_172734.2-390s1c1
	Sequence:CCGGGCACATCTATGCCATGAAGATCTCGAGATCTTCATGGCATAGATGTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022913
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-1333s1c1
	Sequence:CCGGGAGCCCGACTACAAATCCAAACTCGAGTTTGGATTTGTAGTCGGGCTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022909
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-585s1c1
	Sequence:CCGGGCTGATGAAGAAGGACACCTTCTCGAGAAGGTGTCCTTCTTCATCAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362190
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-274s21c1
	Sequence:CCGGACAGAGTTCTTACGCCTTAAGCTCGAGCTTAAGGCGTAAGAACTCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362115
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_172734.2-250s21c1
	Sequence:CCGGCGATCGCAGCATGCTCGTAAACTCGAGTTTACGAGCATGCTGCGATCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362192
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-319s21c1
	Sequence:CCGGTTTGAGTCTCTGAAGGTTATACTCGAGTATAACCTTCAGAGACTCAAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362191
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-455s21c1
	Sequence:CCGGTCCGAGCAGAAAGGGACATTTCTCGAGAAATGTCCCTTTCTGCTCGGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_172734 VALIDATED	STK38L MISSION shRNA shRNA Plasmid DNA serine/threonine kinase 38 like	Mouse

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000022910
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_172734.2-1246s1c1
	Sequence:CCGGCCTATAGAAATCCGGAGTATACTCGAGTATACTCCGGATTTCTATAGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022911
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-1189s1c1
	Sequence:CCGGCATCCGTTCTTTGAGGGTGTACTCGAGTACACCCTCAAAGAACGGATGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022912
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_172734.2-390s1c1
	Sequence:CCGGGCACATCTATGCCATGAAGATCTCGAGATCTTCATGGCATAGATGTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022913
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-1333s1c1
	Sequence:CCGGGAGCCCGACTACAAATCCAAACTCGAGTTTGGATTTGTAGTCGGGCTCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022909
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-585s1c1
	Sequence:CCGGGCTGATGAAGAAGGACACCTTCTCGAGAAGGTGTCCTTCTTCATCAGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362190
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-274s21c1
	Sequence:CCGGACAGAGTTCTTACGCCTTAAGCTCGAGCTTAAGGCGTAAGAACTCTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362115
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_172734.2-250s21c1
	Sequence:CCGGCGATCGCAGCATGCTCGTAAACTCGAGTTTACGAGCATGCTGCGATCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362192
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-319s21c1
	Sequence:CCGGTTTGAGTCTCTGAAGGTTATACTCGAGTATAACCTTCAGAGACTCAAATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362191
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-455s21c1
	Sequence:CCGGTCCGAGCAGAAAGGGACATTTCTCGAGAAATGTCCCTTTCTGCTCGGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_172734 VALIDATED	STK38L MISSION shRNA Lentiviral Transduction Particles serine/threonine kinase 38 like	Mouse

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000022910
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_172734.2-1246s1c1
	Sequence:CCGGCCTATAGAAATCCGGAGTATACTCGAGTATACTCCGGATTTCTATAGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022911
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-1189s1c1
	Sequence:CCGGCATCCGTTCTTTGAGGGTGTACTCGAGTACACCCTCAAAGAACGGATGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022912
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_172734.2-390s1c1
	Sequence:CCGGGCACATCTATGCCATGAAGATCTCGAGATCTTCATGGCATAGATGTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022913
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-1333s1c1
	Sequence:CCGGGAGCCCGACTACAAATCCAAACTCGAGTTTGGATTTGTAGTCGGGCTCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022909
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_172734.2-585s1c1
	Sequence:CCGGGCTGATGAAGAAGGACACCTTCTCGAGAAGGTGTCCTTCTTCATCAGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362190
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-274s21c1
	Sequence:CCGGACAGAGTTCTTACGCCTTAAGCTCGAGCTTAAGGCGTAAGAACTCTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362115
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_172734.2-250s21c1
	Sequence:CCGGCGATCGCAGCATGCTCGTAAACTCGAGTTTACGAGCATGCTGCGATCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362192
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-319s21c1
	Sequence:CCGGTTTGAGTCTCTGAAGGTTATACTCGAGTATAACCTTCAGAGACTCAAATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000362191
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_172734.2-455s21c1
	Sequence:CCGGTCCGAGCAGAAAGGGACATTTCTCGAGAAATGTCCCTTTCTGCTCGGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart