STK3

serine/threonine kinase 3

61 Gene Product Result for

Synonyms: KRS1 MST2

Species: Human STK3(6788), Mouse Stk3(56274), Rat Stk3(65189), cow STK3(533815), sheep STK3(101106085), domestic guinea pig Stk3(100729700), naked mole-rat Stk3(101715099), Zebrafish stk3(324125), chicken STK3(425375), Horse STK3(100060508), dog STK3(475045)

UniProtKB ID: Q13188, A8K722, Q15445, Q15801, Q96FM6

Gene ID:

Human(6788) Summary: This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Mouse(56274) serine/threonine kinase 3

Rat(65189) serine/threonine kinase 3

cow(533815) serine/threonine kinase 3

sheep(101106085) serine/threonine kinase 3

domestic guinea pig(100729700) serine/threonine kinase 3

naked mole-rat(101715099) serine/threonine kinase 3

Zebrafish(324125) serine/threonine kinase 3 (STE20 homolog, yeast)

chicken(425375) serine/threonine kinase 3

Horse(100060508) serine/threonine kinase 3

dog(475045) serine/threonine kinase 3

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB4502885	Anti-MST1 antibody produced in rabbit affinity isolated antibody	mouse, human	ELISA, immunohistochemistry, western blot	pricing

SAB5700552	Anti-Phospho-STK3-T117 antibody produced in rabbit	human, mouse, rat	western blot	pricing

SAB5700553	Anti-Phospho-STK3-T384 antibody produced in rabbit	mouse, human, rat	western blot	pricing

SAB1406492	Anti-STK3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	immunofluorescence, western blot	pricing

HPA007120	Anti-STK3 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	mouse, rat, human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB1404423	Monoclonal Anti-STK3 antibody produced in mouse clone 4F7, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, western blot	pricing

WH0006788M3	Monoclonal Anti-STK3 antibody produced in mouse clone 1E9, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST70211	PrEST Antigen STK3 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST26325	SILu^™PrEST STK3 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

S6573	STK3, active, GST tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR08509	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, STK3	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_006281	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_006281	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_006281	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_019635	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_019635	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_019635	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU083271	MISSION^® esiRNA targeting human STK3	human	pricing

EMU088481	MISSION^® esiRNA targeting mouse Stk3	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_006281	siRNAs that have been validated in the lab	human	pricing
NM_031735	Rosetta Predictions	rat	pricing
NM_019635	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_006281	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00015485 validated	1617
1	SASI_Hs01_00015487 validated	1260
2	SASI_Hs02_00341258 predicted	835
3	SASI_Hs02_00341259 predicted	272
4	SASI_Hs01_00015488 predicted	809
5	SASI_Hs01_00015489 predicted	1514
6	SASI_Hs01_00015490 predicted	1706
7	SASI_Hs01_00015491 predicted	706
8	SASI_Hs01_00015492 predicted	532
9	SASI_Hs01_00015493 predicted	761
10	SASI_Hs01_00015486 predicted	486
11	SASI_Hs01_00015494 predicted	315

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_031735	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00056484 predicted	440
2	SASI_Rn01_00056485 predicted	1606
3	SASI_Rn01_00056486 predicted	443
4	SASI_Rn01_00056487 predicted	756
5	SASI_Rn01_00056488 predicted	275
6	SASI_Rn01_00056489 predicted	1459
7	SASI_Rn01_00056490 predicted	307
8	SASI_Rn01_00056491 predicted	397
9	SASI_Rn01_00056492 predicted	339
10	SASI_Rn01_00056493 predicted	533

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_019635	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00324666 predicted	1794
2	SASI_Mm01_00030699 predicted	611
3	SASI_Mm02_00324667 predicted	1734
4	SASI_Mm02_00324668 predicted	1665
5	SASI_Mm02_00324669 predicted	837
6	SASI_Mm01_00030701 predicted	698
7	SASI_Mm02_00324670 predicted	1789
8	SASI_Mm01_00030702 predicted	496
9	SASI_Mm02_00324671 predicted	1639
10	SASI_Mm02_00324672 predicted	289
11	SASI_Mm01_00030697 predicted	275
12	SASI_Mm01_00030698 predicted	880
13	SASI_Mm01_00030700 predicted	350
14	SASI_Mm01_00030703 predicted	456
15	SASI_Mm01_00030704 predicted	790
16	SASI_Mm01_00030705 predicted	759
17	SASI_Mm01_00030706 predicted	450

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_006281 VALIDATED	STK3 MISSION shRNA Bacterial Glycerol Stock serine/threonine kinase 3	Human

15 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000381880
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1511s21c1
	Sequence:GTACCGGCCATGATGGAACGGGAGATAGCTCGAGCTATCTCCCGTTCCATCATGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195190
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.2-587s1c1
	Sequence:CCGGCTGGAAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTTCCAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195220
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_006281.2-2473s1c1
	Sequence:CCGGCAAACTGTAATAAGCTCATCACTCGAGTGATGAGCTTATTACAGTTTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000315194
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-882s21c1
	Sequence:CCGGGTCCGATGATTTCACCGATTTCTCGAGAAATCGGTGAAATCATCGGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000315193
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1088s21c1
	Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380687
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1479s21c1
	Sequence:GTACCGGAGAACTACAGATGCGGTTAAACTCGAGTTTAACCGCATCTGTAGTTCTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000350498
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_006281.2-287s21c1
	Sequence:CCGGCCGGTCAAGTTGTCGCAATTACTCGAGTAATTGCGACAACTTGACCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002176
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.x-839s1c1
	Sequence:CCGGCCACAAATCCACCACCAACATCTCGAGATGTTGGTGGTGGATTTGTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000315260
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-812s21c1
	Sequence:CCGGTACATCCAATGAGGGCTATTTCTCGAGAAATAGCCCTCATTGGATGTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000315195
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_006281.2-1977s21c1
	Sequence:CCGGTCTAGTATACTAGGCTATTTACTCGAGTAAATAGCCTAGTATACTAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-975s1c1
	Sequence:CCGGGAATGCCAAACCTGTATCAATCTCGAGATTGATACAGGTTTGGCATTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002173
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.63	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-2718s1c1
	Sequence:CCGGGTCATTTCCTAAGCTACATATCTCGAGATATGTAGCTTAGGAAATGACTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002174
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.x-268s1c1
	Sequence:CCGGGCAATACACAAGGAATCCGGTCTCGAGACCGGATTCCTTGTGTATTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002177
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-1085s1c1
	Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380071
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_006281.2-716s21c1
	Sequence:GTACCGGTGATTCAAGAAATAGGCTATACTCGAGTATAGCCTATTTCTTGAATCATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_006281 VALIDATED	STK3 MISSION shRNA shRNA Plasmid DNA serine/threonine kinase 3	Human

15 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000381880
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1511s21c1
	Sequence:GTACCGGCCATGATGGAACGGGAGATAGCTCGAGCTATCTCCCGTTCCATCATGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195190
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.2-587s1c1
	Sequence:CCGGCTGGAAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTTCCAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195220
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_006281.2-2473s1c1
	Sequence:CCGGCAAACTGTAATAAGCTCATCACTCGAGTGATGAGCTTATTACAGTTTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000315194
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-882s21c1
	Sequence:CCGGGTCCGATGATTTCACCGATTTCTCGAGAAATCGGTGAAATCATCGGACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000315193
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1088s21c1
	Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000380687
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1479s21c1
	Sequence:GTACCGGAGAACTACAGATGCGGTTAAACTCGAGTTTAACCGCATCTGTAGTTCTTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000350498
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_006281.2-287s21c1
	Sequence:CCGGCCGGTCAAGTTGTCGCAATTACTCGAGTAATTGCGACAACTTGACCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000002176
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.x-839s1c1
	Sequence:CCGGCCACAAATCCACCACCAACATCTCGAGATGTTGGTGGTGGATTTGTGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000315260
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-812s21c1
	Sequence:CCGGTACATCCAATGAGGGCTATTTCTCGAGAAATAGCCCTCATTGGATGTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000315195
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_006281.2-1977s21c1
	Sequence:CCGGTCTAGTATACTAGGCTATTTACTCGAGTAAATAGCCTAGTATACTAGATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000002175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-975s1c1
	Sequence:CCGGGAATGCCAAACCTGTATCAATCTCGAGATTGATACAGGTTTGGCATTCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000002173
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.63	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-2718s1c1
	Sequence:CCGGGTCATTTCCTAAGCTACATATCTCGAGATATGTAGCTTAGGAAATGACTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000002174
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.x-268s1c1
	Sequence:CCGGGCAATACACAAGGAATCCGGTCTCGAGACCGGATTCCTTGTGTATTGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000002177
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-1085s1c1
	Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000380071
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_006281.2-716s21c1
	Sequence:GTACCGGTGATTCAAGAAATAGGCTATACTCGAGTATAGCCTATTTCTTGAATCATTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_006281 VALIDATED	STK3 MISSION shRNA Lentiviral Transduction Particles serine/threonine kinase 3	Human

15 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000381880
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1511s21c1
	Sequence:GTACCGGCCATGATGGAACGGGAGATAGCTCGAGCTATCTCCCGTTCCATCATGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195190
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.2-587s1c1
	Sequence:CCGGCTGGAAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTTCCAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195220
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_006281.2-2473s1c1
	Sequence:CCGGCAAACTGTAATAAGCTCATCACTCGAGTGATGAGCTTATTACAGTTTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000315194
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-882s21c1
	Sequence:CCGGGTCCGATGATTTCACCGATTTCTCGAGAAATCGGTGAAATCATCGGACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000315193
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1088s21c1
	Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380687
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-1479s21c1
	Sequence:GTACCGGAGAACTACAGATGCGGTTAAACTCGAGTTTAACCGCATCTGTAGTTCTTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000350498
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_006281.2-287s21c1
	Sequence:CCGGCCGGTCAAGTTGTCGCAATTACTCGAGTAATTGCGACAACTTGACCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002176
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.x-839s1c1
	Sequence:CCGGCCACAAATCCACCACCAACATCTCGAGATGTTGGTGGTGGATTTGTGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000315260
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_006281.2-812s21c1
	Sequence:CCGGTACATCCAATGAGGGCTATTTCTCGAGAAATAGCCCTCATTGGATGTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000315195
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_006281.2-1977s21c1
	Sequence:CCGGTCTAGTATACTAGGCTATTTACTCGAGTAAATAGCCTAGTATACTAGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-975s1c1
	Sequence:CCGGGAATGCCAAACCTGTATCAATCTCGAGATTGATACAGGTTTGGCATTCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002173
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.63	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-2718s1c1
	Sequence:CCGGGTCATTTCCTAAGCTACATATCTCGAGATATGTAGCTTAGGAAATGACTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002174
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_006281.x-268s1c1
	Sequence:CCGGGCAATACACAAGGAATCCGGTCTCGAGACCGGATTCCTTGTGTATTGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002177
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_006281.x-1085s1c1
	Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380071
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_006281.2-716s21c1
	Sequence:GTACCGGTGATTCAAGAAATAGGCTATACTCGAGTATAGCCTATTTCTTGAATCATTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_019635 VALIDATED	STK3 MISSION shRNA Bacterial Glycerol Stock serine/threonine kinase 3	Mouse

11 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000274762
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-700s21c1
	Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000274761
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-925s21c1
	Sequence:CCGGTACATCCGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCGGATGTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000274760
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1861s21c1
	Sequence:CCGGTGATGGTACACACCTAGATAACTCGAGTTATCTAGGTGTGTACCATCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000274759
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1641s21c1
	Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323443
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019635.2-822s21c2
	Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000374326
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.58	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1983s21c1
	Sequence:CCGGCTGCAAGAGAACTAATCTAAACTCGAGTTTAGATTAGTTCTCTTGCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025940
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-1519s1c1
	Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025960
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019635.1-579s1c1
	Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025947
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-293s1c1
	Sequence:CCGGGCAATTAAGCAAGTACCTGTTCTCGAGAACAGGTACTTGCTTAATTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025951
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019635.1-701s1c1
	Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025880
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-1322s1c1
	Sequence:CCGGCCTTCTTTCATGGACTACTTTCTCGAGAAAGTAGTCCATGAAAGAAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_019635 VALIDATED	STK3 MISSION shRNA shRNA Plasmid DNA serine/threonine kinase 3	Mouse

11 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000274762
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-700s21c1
	Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000274761
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-925s21c1
	Sequence:CCGGTACATCCGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCGGATGTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000274760
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1861s21c1
	Sequence:CCGGTGATGGTACACACCTAGATAACTCGAGTTATCTAGGTGTGTACCATCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000274759
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1641s21c1
	Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000323443
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019635.2-822s21c2
	Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000374326
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.58	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1983s21c1
	Sequence:CCGGCTGCAAGAGAACTAATCTAAACTCGAGTTTAGATTAGTTCTCTTGCAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025940
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-1519s1c1
	Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025960
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019635.1-579s1c1
	Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025947
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-293s1c1
	Sequence:CCGGGCAATTAAGCAAGTACCTGTTCTCGAGAACAGGTACTTGCTTAATTGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025951
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019635.1-701s1c1
	Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025880
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-1322s1c1
	Sequence:CCGGCCTTCTTTCATGGACTACTTTCTCGAGAAAGTAGTCCATGAAAGAAGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_019635 VALIDATED	STK3 MISSION shRNA Lentiviral Transduction Particles serine/threonine kinase 3	Mouse

11 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000274762
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-700s21c1
	Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000274761
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-925s21c1
	Sequence:CCGGTACATCCGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCGGATGTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000274760
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.62	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1861s21c1
	Sequence:CCGGTGATGGTACACACCTAGATAACTCGAGTTATCTAGGTGTGTACCATCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000274759
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1641s21c1
	Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323443
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_019635.2-822s21c2
	Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000374326
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.58	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_019635.2-1983s21c1
	Sequence:CCGGCTGCAAGAGAACTAATCTAAACTCGAGTTTAGATTAGTTCTCTTGCAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025940
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-1519s1c1
	Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025960
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019635.1-579s1c1
	Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025947
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-293s1c1
	Sequence:CCGGGCAATTAAGCAAGTACCTGTTCTCGAGAACAGGTACTTGCTTAATTGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025951
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_019635.1-701s1c1
	Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025880
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_019635.1-1322s1c1
	Sequence:CCGGCCTTCTTTCATGGACTACTTTCTCGAGAAAGTAGTCCATGAAAGAAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart