STX1A

syntaxin 1A (brain)

93 Gene Product Result for

Synonyms: HPC-1 P35-1 STX1 SYN1A

Species: Human STX1A(6804), Mouse Stx1a(20907), Rat Stx1a(116470), cow STX1A(788566), sheep STX1A(101112696), domestic guinea pig Stx1a(100727115), naked mole-rat Stx1a(101701572), chicken STX1A(770216), domestic cat STX1A(101097118), dog STX1A(607840)

UniProtKB ID: Q16623, O15447, O15448, Q12936, Q75MD9, Q9BPZ6

Gene ID:

Human(6804) Summary: This gene encodes a member of the syntaxin superfamily. Syntaxins are nervous system-specific proteins implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. Syntaxins possess a single C-terminal transmembrane domain, a SNARE [Soluble NSF (N-ethylmaleimide-sensitive fusion protein)-Attachment protein REceptor]

Mouse(20907) syntaxin 1A (brain)

Rat(116470) syntaxin 1A (brain)

cow(788566) syntaxin 1A (brain)

sheep(101112696) syntaxin 1A (brain)

domestic guinea pig(100727115) syntaxin 1A (brain)

naked mole-rat(101701572) syntaxin 1A (brain)

chicken(770216) syntaxin 1A (brain)

domestic cat(101097118) syntaxin 1A (brain)

dog(607840) syntaxin 1A (brain)

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB4504321	Anti-phospho-Syntaxin 1A (pSer¹⁴) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunofluorescence, western blot	pricing

SAB4301555	Anti-phospho-Syntaxin 1A (pSer¹⁴) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	western blot	pricing

SAB1406496	Anti-STX1A antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	immunohistochemistry, western blot	pricing

SAB2108435	Anti-STX1A antibody produced in rabbit affinity isolated antibody	rabbit, human, dog, mouse, guinea pig, horse, rat, bovine	western blot	pricing

SAB2102329	Anti-STX1A antibody produced in rabbit affinity isolated antibody	bovine, rat, human, guinea pig, dog, mouse	western blot	pricing

SAB2107400	Anti-STX1A antibody produced in rabbit affinity isolated antibody, lyophilized powder	horse, mouse, rabbit, human	ELISA, western blot	pricing

HPA069176	Anti-STX1A antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunohistochemistry	pricing

SAB2501001	Anti-STX1A/STX1B2 antibody produced in goat affinity isolated antibody, buffered aqueous solution	mouse, human, canine, rat	ELISA, western blot	pricing

S1172	Anti-Syntaxin 1 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder	rat, mouse	immunohistochemistry, western blot	pricing

SAB5500181	Anti-Syntaxin 1A antibody, Rabbit monoclonal clone SP36, recombinant, expressed in proprietary host, affinity isolated antibody	human (tested)	immunohistochemistry	pricing

SAB4502894	Anti-Syntaxin 1A, N-Terminal antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

WH0006804M1	Monoclonal Anti-STX1A antibody produced in mouse clone 1F9-1C9, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

SAB1404425	Monoclonal Anti-STX1A antibody produced in mouse clone 1B11-1A8, purified immunoglobulin, buffered aqueous solution	rat, human	ELISA, immunofluorescence, western blot	pricing

S0664	Monoclonal Anti-Syntaxin antibody produced in mouse clone HPC-1, ascites fluid	rabbit, bovine, rat	immunocytochemistry, microarray, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN20782	CompoZr^® Knockout ZFN Kit Human STX1A (NM_004603)	pricing

CKOZFN42241	CompoZr^® Knockout ZFN Kit Mouse Stx1a (NM_016801.3)	pricing

CKOZFN63654	CompoZr^® Knockout ZFN Kit Rat Stx1a (NM_053788)	pricing

CKOZFND20782	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human STX1A (NM_004603)	pricing

CKOZFND42241	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Stx1a (NM_016801.3)	pricing

CKOZFND63654	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Stx1a (NM_053788)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST90498	PrEST Antigen STX1A Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_004603	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_004603	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_004603	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_016801	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_016801	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_016801	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU143351	MISSION^® esiRNA esiRNA human STX1A (esiRNA1)	human	pricing

EMU060641	MISSION^® esiRNA esiRNA targeting mouse Stx1a (esiRNA1)	mouse	pricing

Related Products

Product #	Description	Add to Cart

AB5820	Anti-Syntaxin 1 Antibody Detect Syntaxin 1 using this Anti-Syntaxin 1 Antibody validated for use in WB, IH.	pricing

AB5820-50UL	Anti-Syntaxin 1 Antibody This Anti-Syntaxin 1 Antibody is validated for use in WB, IH for the detection of Syntaxin 1.	pricing

MAB325	Anti-Syntaxin Antibody, clone SP7 Anti-Syntaxin Antibody, clone SP7 is an antibody against Syntaxin for use in ELISA, WB, IH.	pricing

MAB336	Anti-Syntaxin Antibody, clone SP8 This Anti-Syntaxin Antibody, clone SP8 is validated for use in ELISA, WB, IH for the detection of Syntaxin.	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_004603	Rosetta Predictions	human	pricing
NM_053788	Rosetta Predictions	rat	pricing
NM_016801	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_004603	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00197740 predicted	384
2	SASI_Hs02_00337981 predicted	1072
3	SASI_Hs01_00197742 predicted	734
4	SASI_Hs01_00197743 predicted	1054
5	SASI_Hs01_00197744 predicted	735
6	SASI_Hs01_00197745 predicted	1386
7	SASI_Hs01_00197746 predicted	1079
8	SASI_Hs01_00197747 predicted	354
9	SASI_Hs01_00197748 predicted	1382
10	SASI_Hs01_00197749 predicted	244
11	SASI_Hs01_00197741 predicted	898

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_053788	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00065142 predicted	779
2	SASI_Rn02_00266594 predicted	838
3	SASI_Rn01_00065144 predicted	385
4	SASI_Rn01_00065145 predicted	620
5	SASI_Rn01_00065146 predicted	1075
6	SASI_Rn01_00065148 predicted	395
7	SASI_Rn01_00065149 predicted	658
8	SASI_Rn01_00065150 predicted	593
9	SASI_Rn01_00065151 predicted	522
10	SASI_Rn02_00266595 predicted	285
11	SASI_Rn01_00065143 predicted	411
12	SASI_Rn01_00065147 predicted	547

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_016801	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00022885 predicted	385
2	SASI_Mm01_00022886 predicted	267
3	SASI_Mm01_00022887 predicted	1046
4	SASI_Mm01_00022888 predicted	1076
5	SASI_Mm01_00022890 predicted	1093
6	SASI_Mm01_00022891 predicted	377
7	SASI_Mm01_00022892 predicted	567
8	SASI_Mm01_00022893 predicted	258
9	SASI_Mm01_00022894 predicted	769
10	SASI_Mm02_00323590 predicted	640
11	SASI_Mm01_00022889 predicted	1109

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_004603 VALIDATED	STX1A MISSION shRNA Bacterial Glycerol Stock syntaxin 1A (brain)	Human

16 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000065009
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-372s1c1
	Sequence:CCGGCCAGAAAGTTTGTGGAGGTCACTCGAGTGACCTCCACAAACTTTCTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065010
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-113s1c1
	Sequence:CCGGGAGGAGATTCGAGGCTTCATTCTCGAGAATGAAGCCTCGAATCTCCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065011
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-695s1c1
	Sequence:CCGGAGGATCGAGTACAATGTGGAACTCGAGTTCCACATTGTACTCGATCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065008
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-227s1c1
	Sequence:CCGGGAAGAACTCATGTCCGACATACTCGAGTATGTCGGACATGAGTTCTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065012
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-244s1c1
	Sequence:CCGGCATAAAGAAGACAGCAAACAACTCGAGTTGTTTGCTGTCTTCTTTATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381844
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-411s21c1
	Sequence:GTACCGGGGAGGTCATGTCGGAGTACAACTCGAGTTGTACTCCGACATGACCTCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380705
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004603.2-1385s21c1
	Sequence:GTACCGGTGAGTCTCAGTCGCTGATCACCTCGAGGTGATCAGCGACTGAGACTCATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218716
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-255s21c1
	Sequence:GTACCGGAGAACTCATGTCCGACATAAACTCGAGTTTATGTCGGACATGAGTTCTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000382305
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-386s21c1
	Sequence:GTACCGGACTCCACGCTGTCCAGAAAGTCTCGAGACTTTCTGGACAGCGTGGAGTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000257133
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-140s21c1
	Sequence:CCGGAGGAGATTCGAGGCTTCATTGCTCGAGCAATGAAGCCTCGAATCTCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230306
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-1631s21c1
	Sequence:CCGGCAAGCCAGCGTTGCATGTTTGCTCGAGCAAACATGCAACGCTGGCTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230305
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-716s21c1
	Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000257113
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-288s21c1
	Sequence:CCGGCAAAGTTCGTTCCAAGTTAAACTCGAGTTTAACTTGGAACGAACTTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380398
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-739s21c1
	Sequence:GTACCGGGAACACGCGGTAGACTATGTGCTCGAGCACATAGTCTACCGCGTGTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381955
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-555s21c1
	Sequence:GTACCGGCTTTGCCTCTGGGATCATCATCTCGAGATGATGATCCCAGAGGCAAAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381347
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004603.2-1075s21c1
	Sequence:GTACCGGCTCTGTGAGTGTGCGTCTGTACTCGAGTACAGACGCACACTCACAGAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_004603 VALIDATED	STX1A MISSION shRNA shRNA Plasmid DNA syntaxin 1A (brain)	Human

16 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000065009
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-372s1c1
	Sequence:CCGGCCAGAAAGTTTGTGGAGGTCACTCGAGTGACCTCCACAAACTTTCTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065010
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-113s1c1
	Sequence:CCGGGAGGAGATTCGAGGCTTCATTCTCGAGAATGAAGCCTCGAATCTCCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065011
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-695s1c1
	Sequence:CCGGAGGATCGAGTACAATGTGGAACTCGAGTTCCACATTGTACTCGATCCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065008
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-227s1c1
	Sequence:CCGGGAAGAACTCATGTCCGACATACTCGAGTATGTCGGACATGAGTTCTTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065012
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-244s1c1
	Sequence:CCGGCATAAAGAAGACAGCAAACAACTCGAGTTGTTTGCTGTCTTCTTTATGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381844
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-411s21c1
	Sequence:GTACCGGGGAGGTCATGTCGGAGTACAACTCGAGTTGTACTCCGACATGACCTCCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380705
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004603.2-1385s21c1
	Sequence:GTACCGGTGAGTCTCAGTCGCTGATCACCTCGAGGTGATCAGCGACTGAGACTCATTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218716
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-255s21c1
	Sequence:GTACCGGAGAACTCATGTCCGACATAAACTCGAGTTTATGTCGGACATGAGTTCTTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000382305
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-386s21c1
	Sequence:GTACCGGACTCCACGCTGTCCAGAAAGTCTCGAGACTTTCTGGACAGCGTGGAGTTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000257133
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-140s21c1
	Sequence:CCGGAGGAGATTCGAGGCTTCATTGCTCGAGCAATGAAGCCTCGAATCTCCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230306
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-1631s21c1
	Sequence:CCGGCAAGCCAGCGTTGCATGTTTGCTCGAGCAAACATGCAACGCTGGCTTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230305
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-716s21c1
	Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000257113
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-288s21c1
	Sequence:CCGGCAAAGTTCGTTCCAAGTTAAACTCGAGTTTAACTTGGAACGAACTTTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380398
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-739s21c1
	Sequence:GTACCGGGAACACGCGGTAGACTATGTGCTCGAGCACATAGTCTACCGCGTGTTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381955
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-555s21c1
	Sequence:GTACCGGCTTTGCCTCTGGGATCATCATCTCGAGATGATGATCCCAGAGGCAAAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381347
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004603.2-1075s21c1
	Sequence:GTACCGGCTCTGTGAGTGTGCGTCTGTACTCGAGTACAGACGCACACTCACAGAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_004603 VALIDATED	STX1A MISSION shRNA Lentiviral Transduction Particles syntaxin 1A (brain)	Human

16 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000065009
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-372s1c1
	Sequence:CCGGCCAGAAAGTTTGTGGAGGTCACTCGAGTGACCTCCACAAACTTTCTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065010
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-113s1c1
	Sequence:CCGGGAGGAGATTCGAGGCTTCATTCTCGAGAATGAAGCCTCGAATCTCCTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065011
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-695s1c1
	Sequence:CCGGAGGATCGAGTACAATGTGGAACTCGAGTTCCACATTGTACTCGATCCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065008
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-227s1c1
	Sequence:CCGGGAAGAACTCATGTCCGACATACTCGAGTATGTCGGACATGAGTTCTTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000065012
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004603.1-244s1c1
	Sequence:CCGGCATAAAGAAGACAGCAAACAACTCGAGTTGTTTGCTGTCTTCTTTATGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381844
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-411s21c1
	Sequence:GTACCGGGGAGGTCATGTCGGAGTACAACTCGAGTTGTACTCCGACATGACCTCCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380705
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004603.2-1385s21c1
	Sequence:GTACCGGTGAGTCTCAGTCGCTGATCACCTCGAGGTGATCAGCGACTGAGACTCATTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218716
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-255s21c1
	Sequence:GTACCGGAGAACTCATGTCCGACATAAACTCGAGTTTATGTCGGACATGAGTTCTTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000382305
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-386s21c1
	Sequence:GTACCGGACTCCACGCTGTCCAGAAAGTCTCGAGACTTTCTGGACAGCGTGGAGTTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000257133
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-140s21c1
	Sequence:CCGGAGGAGATTCGAGGCTTCATTGCTCGAGCAATGAAGCCTCGAATCTCCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230306
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-1631s21c1
	Sequence:CCGGCAAGCCAGCGTTGCATGTTTGCTCGAGCAAACATGCAACGCTGGCTTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230305
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-716s21c1
	Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000257113
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 2	Clone ID:NM_004603.2-288s21c1
	Sequence:CCGGCAAAGTTCGTTCCAAGTTAAACTCGAGTTTAACTTGGAACGAACTTTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380398
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-739s21c1
	Sequence:GTACCGGGAACACGCGGTAGACTATGTGCTCGAGCACATAGTCTACCGCGTGTTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381955
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004603.2-555s21c1
	Sequence:GTACCGGCTTTGCCTCTGGGATCATCATCTCGAGATGATGATCCCAGAGGCAAAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381347
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004603.2-1075s21c1
	Sequence:GTACCGGCTCTGTGAGTGTGCGTCTGTACTCGAGTACAGACGCACACTCACAGAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_016801 VALIDATED	STX1A MISSION shRNA Bacterial Glycerol Stock syntaxin 1A (brain)	Mouse

13 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000110580
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_016801.2-1363s1c1
	Sequence:CCGGGCTCAGCACTGAGTCTTTGTTCTCGAGAACAAAGACTCAGTGCTGAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110581
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016801.2-277s1c1
	Sequence:CCGGCGCTCCAAGCTAAAGAGCATTCTCGAGAATGCTCTTTAGCTTGGAGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110582
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016801.2-91s1c1
	Sequence:CCGGCGCTTCATGGATGAATTCTTTCTCGAGAAAGAATTCATCCATGAAGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110583
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016801.2-693s1c1
	Sequence:CCGGGATGATTGACAGGATCGAGTACTCGAGTACTCGATCCTGTCAATCATCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110584
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016801.2-487s1c1
	Sequence:CCGGACGACCAGTGAGGAATTGGAACTCGAGTTCCAATTCCTCACTGGTCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236766
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-698s21c1
	Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380322
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-427s21c1
	Sequence:GTACCGGGACTACCGAGAACGCTGCAAACTCGAGTTTGCAGCGTTCTCGGTAGTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236762
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-484s21c1
	Sequence:CCGGACCACGACCAGTGAGGAATTGCTCGAGCAATTCCTCACTGGTCGTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236764
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_016801.3-1511s21c1
	Sequence:CCGGGCCTAGTGACCCTTTACTAAGCTCGAGCTTAGTAAAGGGTCACTAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236765
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-270s21c1
	Sequence:CCGGCAAAGTTCGCTCCAAGCTAAACTCGAGTTTAGCTTGGAGCGAACTTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236763
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-237s21c1
	Sequence:CCGGGGAGCTCATGTCGGACATTAACTCGAGTTAATGTCCGACATGAGCTCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380092
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-370s21c1
	Sequence:GTACCGGTCCACGCTGTCCCGAAAGTTTCTCGAGAAACTTTCGGGACAGCGTGGATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381307
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-393s21c1
	Sequence:GTACCGGGGAGGTCATGTCCGAGTACAACTCGAGTTGTACTCGGACATGACCTCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_016801 VALIDATED	STX1A MISSION shRNA shRNA Plasmid DNA syntaxin 1A (brain)	Mouse

13 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000110580
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_016801.2-1363s1c1
	Sequence:CCGGGCTCAGCACTGAGTCTTTGTTCTCGAGAACAAAGACTCAGTGCTGAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110581
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016801.2-277s1c1
	Sequence:CCGGCGCTCCAAGCTAAAGAGCATTCTCGAGAATGCTCTTTAGCTTGGAGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110582
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016801.2-91s1c1
	Sequence:CCGGCGCTTCATGGATGAATTCTTTCTCGAGAAAGAATTCATCCATGAAGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110583
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016801.2-693s1c1
	Sequence:CCGGGATGATTGACAGGATCGAGTACTCGAGTACTCGATCCTGTCAATCATCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110584
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016801.2-487s1c1
	Sequence:CCGGACGACCAGTGAGGAATTGGAACTCGAGTTCCAATTCCTCACTGGTCGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236766
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-698s21c1
	Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380322
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-427s21c1
	Sequence:GTACCGGGACTACCGAGAACGCTGCAAACTCGAGTTTGCAGCGTTCTCGGTAGTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236762
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-484s21c1
	Sequence:CCGGACCACGACCAGTGAGGAATTGCTCGAGCAATTCCTCACTGGTCGTGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236764
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_016801.3-1511s21c1
	Sequence:CCGGGCCTAGTGACCCTTTACTAAGCTCGAGCTTAGTAAAGGGTCACTAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236765
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-270s21c1
	Sequence:CCGGCAAAGTTCGCTCCAAGCTAAACTCGAGTTTAGCTTGGAGCGAACTTTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236763
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-237s21c1
	Sequence:CCGGGGAGCTCATGTCGGACATTAACTCGAGTTAATGTCCGACATGAGCTCCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380092
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-370s21c1
	Sequence:GTACCGGTCCACGCTGTCCCGAAAGTTTCTCGAGAAACTTTCGGGACAGCGTGGATTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381307
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-393s21c1
	Sequence:GTACCGGGGAGGTCATGTCCGAGTACAACTCGAGTTGTACTCGGACATGACCTCCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_016801 VALIDATED	STX1A MISSION shRNA Lentiviral Transduction Particles syntaxin 1A (brain)	Mouse

13 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000110580
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_016801.2-1363s1c1
	Sequence:CCGGGCTCAGCACTGAGTCTTTGTTCTCGAGAACAAAGACTCAGTGCTGAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110581
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016801.2-277s1c1
	Sequence:CCGGCGCTCCAAGCTAAAGAGCATTCTCGAGAATGCTCTTTAGCTTGGAGCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110582
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016801.2-91s1c1
	Sequence:CCGGCGCTTCATGGATGAATTCTTTCTCGAGAAAGAATTCATCCATGAAGCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110583
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_016801.2-693s1c1
	Sequence:CCGGGATGATTGACAGGATCGAGTACTCGAGTACTCGATCCTGTCAATCATCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000110584
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_016801.2-487s1c1
	Sequence:CCGGACGACCAGTGAGGAATTGGAACTCGAGTTCCAATTCCTCACTGGTCGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236766
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-698s21c1
	Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380322
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-427s21c1
	Sequence:GTACCGGGACTACCGAGAACGCTGCAAACTCGAGTTTGCAGCGTTCTCGGTAGTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236762
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_016801.3-484s21c1
	Sequence:CCGGACCACGACCAGTGAGGAATTGCTCGAGCAATTCCTCACTGGTCGTGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236764
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_016801.3-1511s21c1
	Sequence:CCGGGCCTAGTGACCCTTTACTAAGCTCGAGCTTAGTAAAGGGTCACTAGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236765
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-270s21c1
	Sequence:CCGGCAAAGTTCGCTCCAAGCTAAACTCGAGTTTAGCTTGGAGCGAACTTTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000236763
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-237s21c1
	Sequence:CCGGGGAGCTCATGTCGGACATTAACTCGAGTTAATGTCCGACATGAGCTCCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380092
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-370s21c1
	Sequence:GTACCGGTCCACGCTGTCCCGAAAGTTTCTCGAGAAACTTTCGGGACAGCGTGGATTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381307
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_016801.3-393s21c1
	Sequence:GTACCGGGGAGGTCATGTCCGAGTACAACTCGAGTTGTACTCGGACATGACCTCCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart