EMAIL THIS PAGE TO A FRIEND

SUSD2

sushi domain containing 2

43 Gene Product Result for
Synonyms: BK65A6.2
UniProtKB ID: Q9UGT4, Q9H5Y6
Gene ID:
Mouse(71733) sushi domain containing 2
Rat(294335) sushi domain containing 2
domestic guinea pig(100718158) sushi domain containing 2
naked mole-rat(101723909) sushi domain containing 2
Domestic Rabbit(100358655) sushi domain containing 2
cow(510458) sushi domain containing 2
chicken(416922) sushi domain containing 2
Horse(100053323) sushi domain containing 2
domestic cat(101092298) sushi domain containing 2
dog(486402) sushi domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019601 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019601 Rosetta Predictions human pricing
NM_001106381 Rosetta Predictions rat pricing
NM_027890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212241 predicted 309
2 SASI_Hs01_00212242 predicted 2608
3 SASI_Hs01_00212243 predicted 1393
4 SASI_Hs02_00352804 predicted 1431
5 SASI_Hs01_00212245 predicted 341
6 SASI_Hs01_00212246 predicted 876
7 SASI_Hs01_00212247 predicted 2804
8 SASI_Hs01_00212248 predicted 2381
9 SASI_Hs01_00212249 predicted 2093
10 SASI_Hs01_00212250 predicted 517
11 SASI_Hs01_00212244 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218408 predicted 1662
2 SASI_Rn02_00218409 predicted 1049
3 SASI_Rn02_00218410 predicted 352
4 SASI_Rn02_00218411 predicted 1749
5 SASI_Rn02_00218412 predicted 2609
6 SASI_Rn02_00218413 predicted 708
7 SASI_Rn02_00218414 predicted 240
8 SASI_Rn02_00218415 predicted 2513
9 SASI_Rn02_00218416 predicted 1941
10 SASI_Rn02_00218417 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123985 predicted 526
2 SASI_Mm01_00123986 predicted 2224
3 SASI_Mm01_00123987 predicted 380
4 SASI_Mm01_00123988 predicted 1272
5 SASI_Mm01_00123989 predicted 995
6 SASI_Mm01_00123990 predicted 1029
7 SASI_Mm01_00123991 predicted 1020
8 SASI_Mm01_00123992 predicted 1697
9 SASI_Mm01_00123993 predicted 1840
10 SASI_Mm01_00123994 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027890
SUSD2 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027890.3-2923s1c1
Sequence:CCGGCCAGAGCTAAACTGCCTTGATCTCGAGATCAAGGCAGTTTAGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-1951s1c1
Sequence:CCGGCCCTGTTTACTTATGACTCTTCTCGAGAAGAGTCATAAGTAAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-524s1c1
Sequence:CCGGCGAGACCCATTGGCAATACTACTCGAGTAGTATTGCCAATGGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-1282s1c1
Sequence:CCGGGCTTCTATTACTGCTGTCTTTCTCGAGAAAGACAGCAGTAATAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-407s1c1
Sequence:CCGGCGGCTATATTCCCTTCACCATCTCGAGATGGTGAAGGGAATATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-2453s21c1
Sequence:CCGGACTGATCTCTATCATCTATATCTCGAGATATAGATGATAGAGATCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027890.5-2699s21c1
Sequence:CCGGCATGATACCGGATAGTCTTAACTCGAGTTAAGACTATCCGGTATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-287s21c1
Sequence:CCGGAGACTTCGTGGTGCAACATTTCTCGAGAAATGTTGCACCACGAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-1450s21c1
Sequence:CCGGTCAGCGGCAATGGCGAATATGCTCGAGCATATTCGCCATTGCCGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-2296s21c1
Sequence:CCGGTCCGATTCAGCTGCAACAATGCTCGAGCATTGTTGCAGCTGAATCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027890
SUSD2 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027890.3-2923s1c1
Sequence:CCGGCCAGAGCTAAACTGCCTTGATCTCGAGATCAAGGCAGTTTAGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-1951s1c1
Sequence:CCGGCCCTGTTTACTTATGACTCTTCTCGAGAAGAGTCATAAGTAAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-524s1c1
Sequence:CCGGCGAGACCCATTGGCAATACTACTCGAGTAGTATTGCCAATGGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-1282s1c1
Sequence:CCGGGCTTCTATTACTGCTGTCTTTCTCGAGAAAGACAGCAGTAATAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-407s1c1
Sequence:CCGGCGGCTATATTCCCTTCACCATCTCGAGATGGTGAAGGGAATATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-2453s21c1
Sequence:CCGGACTGATCTCTATCATCTATATCTCGAGATATAGATGATAGAGATCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027890.5-2699s21c1
Sequence:CCGGCATGATACCGGATAGTCTTAACTCGAGTTAAGACTATCCGGTATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-287s21c1
Sequence:CCGGAGACTTCGTGGTGCAACATTTCTCGAGAAATGTTGCACCACGAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-1450s21c1
Sequence:CCGGTCAGCGGCAATGGCGAATATGCTCGAGCATATTCGCCATTGCCGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-2296s21c1
Sequence:CCGGTCCGATTCAGCTGCAACAATGCTCGAGCATTGTTGCAGCTGAATCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027890
SUSD2 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027890.3-2923s1c1
Sequence:CCGGCCAGAGCTAAACTGCCTTGATCTCGAGATCAAGGCAGTTTAGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-1951s1c1
Sequence:CCGGCCCTGTTTACTTATGACTCTTCTCGAGAAGAGTCATAAGTAAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-524s1c1
Sequence:CCGGCGAGACCCATTGGCAATACTACTCGAGTAGTATTGCCAATGGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-1282s1c1
Sequence:CCGGGCTTCTATTACTGCTGTCTTTCTCGAGAAAGACAGCAGTAATAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027890.3-407s1c1
Sequence:CCGGCGGCTATATTCCCTTCACCATCTCGAGATGGTGAAGGGAATATAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-2453s21c1
Sequence:CCGGACTGATCTCTATCATCTATATCTCGAGATATAGATGATAGAGATCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027890.5-2699s21c1
Sequence:CCGGCATGATACCGGATAGTCTTAACTCGAGTTAAGACTATCCGGTATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-287s21c1
Sequence:CCGGAGACTTCGTGGTGCAACATTTCTCGAGAAATGTTGCACCACGAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-1450s21c1
Sequence:CCGGTCAGCGGCAATGGCGAATATGCTCGAGCATATTCGCCATTGCCGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027890.5-2296s21c1
Sequence:CCGGTCCGATTCAGCTGCAACAATGCTCGAGCATTGTTGCAGCTGAATCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019601
SUSD2 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-316s1c1
Sequence:CCGGCCAGTGTGATCTGCAGGTTTACTCGAGTAAACCTGCAGATCACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-2097s1c1
Sequence:CCGGGACGATCATTTCTGCAACTTTCTCGAGAAAGTTGCAGAAATGATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-1286s1c1
Sequence:CCGGCAGCTTCTATTACTGCTGCCTCTCGAGAGGCAGCAGTAATAGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-2282s1c1
Sequence:CCGGCATCTACTTCCACTGTGACAACTCGAGTTGTCACAGTGGAAGTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-527s21c1
Sequence:CCGGGAACGAGACGCGTTGGCAATACTCGAGTATTGCCAACGCGTCTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-1419s21c1
Sequence:CCGGGACGGCACCAACTTCACATTCCTCGAGGAATGTGAAGTTGGTGCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-208s21c1
Sequence:CCGGGCTTGGATTTCCGGGACTTCTCTCGAGAGAAGTCCCGGAAATCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019601.3-2724s21c1
Sequence:CCGGCCAAATACTCACGGCTCTAATCTCGAGATTAGAGCCGTGAGTATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019601
SUSD2 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-316s1c1
Sequence:CCGGCCAGTGTGATCTGCAGGTTTACTCGAGTAAACCTGCAGATCACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-2097s1c1
Sequence:CCGGGACGATCATTTCTGCAACTTTCTCGAGAAAGTTGCAGAAATGATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-1286s1c1
Sequence:CCGGCAGCTTCTATTACTGCTGCCTCTCGAGAGGCAGCAGTAATAGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-2282s1c1
Sequence:CCGGCATCTACTTCCACTGTGACAACTCGAGTTGTCACAGTGGAAGTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-527s21c1
Sequence:CCGGGAACGAGACGCGTTGGCAATACTCGAGTATTGCCAACGCGTCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-1419s21c1
Sequence:CCGGGACGGCACCAACTTCACATTCCTCGAGGAATGTGAAGTTGGTGCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-208s21c1
Sequence:CCGGGCTTGGATTTCCGGGACTTCTCTCGAGAGAAGTCCCGGAAATCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019601.3-2724s21c1
Sequence:CCGGCCAAATACTCACGGCTCTAATCTCGAGATTAGAGCCGTGAGTATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019601
SUSD2 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-316s1c1
Sequence:CCGGCCAGTGTGATCTGCAGGTTTACTCGAGTAAACCTGCAGATCACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-2097s1c1
Sequence:CCGGGACGATCATTTCTGCAACTTTCTCGAGAAAGTTGCAGAAATGATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-1286s1c1
Sequence:CCGGCAGCTTCTATTACTGCTGCCTCTCGAGAGGCAGCAGTAATAGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019601.2-2282s1c1
Sequence:CCGGCATCTACTTCCACTGTGACAACTCGAGTTGTCACAGTGGAAGTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-527s21c1
Sequence:CCGGGAACGAGACGCGTTGGCAATACTCGAGTATTGCCAACGCGTCTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-1419s21c1
Sequence:CCGGGACGGCACCAACTTCACATTCCTCGAGGAATGTGAAGTTGGTGCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019601.3-208s21c1
Sequence:CCGGGCTTGGATTTCCGGGACTTCTCTCGAGAGAAGTCCCGGAAATCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019601.3-2724s21c1
Sequence:CCGGCCAAATACTCACGGCTCTAATCTCGAGATTAGAGCCGTGAGTATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)