EMAIL THIS PAGE TO A FRIEND

SYP

synaptophysin

55 Gene Product Result for
Synonyms: MRXSYP
UniProtKB ID: P08247, B2R7L6, Q6P2F7
Gene ID:
Human(6855) Summary: This gene encodes an integral membrane protein of small synaptic vesicles in brain and endocrine cells. The protein also binds cholesterol and is thought to direct targeting of vesicle-associated membrane protein 2 (synaptobrevin) to intracellular compartments. Mutations in this gene are associated with X-linked mental retardation (XLMR). [provided by RefSeq, Aug 2011]
Mouse(20977) synaptophysin
Rat(24804) synaptophysin
dog(612557) synaptophysin
domestic cat(101084343) synaptophysin
cow(280937) synaptophysin
sheep(101112034) synaptophysin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB9272 Anti-Synaptophysin Antibody clone, Chemicon®, from rabbit rat, human
immunohistochemistry, western blot pricing
SAB4502906 Anti-Synaptophysin antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
MAB329 Anti-Synaptophysin Antibody, clone SP15 ascites fluid, clone SP15, Chemicon® hamster, pig, rat, human
ELISA, immunohistochemistry, western blot pricing
MAB329-C Anti-Synaptophysin Antibody, clone SP15 (Ascites Free) clone SP15, from mouse human, monkey, feline, mouse, rat
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing
MAB5258 Anti-Synaptophysin Antibody, clone SY38 clone SY38, Chemicon®, from mouse rat, human, bovine, avian, mouse, fish
flow cytometry, immunocytochemistry, immunohistochemistry, western blot pricing
MAB5258-I Anti-Synaptophysin Antibody, clone SY38 clone SY38, from mouse bovine, mouse, rat, mouse, bovine, human, human, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
MAB5258A4 Anti-Synaptophysin Antibody, clone SY38, Alexa Fluor 488 Conjugate clone SY38, from mouse, ALEXA FLUOR® 488 mouse, human, mouse
immunohistochemistry pricing
MAB5258-AF555 Anti-Synaptophysin Antibody, clone SY38, AlexaFluor 555 Conjugate clone SY38, from mouse, ALEXA FLUOR® 555 rat, rat, mouse, mouse
immunocytochemistry pricing
SAB5500180 Anti-Synaptophysin antibody, Rabbit monoclonal clone SP11, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry, western blot pricing
HPA002858 Anti-SYP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB2102352 Anti-SYP antibody produced in rabbit affinity isolated antibody goat, rat, human, guinea pig, bovine, horse, mouse
immunohistochemistry, western blot pricing
S5768 Monoclonal Anti-Synaptophysin antibody produced in mouse clone SVP-38, ascites fluid human, guinea pig, rat, pig
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003179 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003179 Rosetta Predictions human pricing
NM_012664 Rosetta Predictions rat pricing
NM_009305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030359 predicted 594
2 SASI_Hs01_00030360 predicted 473
3 SASI_Hs01_00030361 predicted 280
4 SASI_Hs01_00030363 predicted 663
5 SASI_Hs01_00030364 predicted 314
6 SASI_Hs01_00030365 predicted 249
7 SASI_Hs01_00030366 predicted 393
8 SASI_Hs01_00030367 predicted 203
9 SASI_Hs02_00335204 predicted 204
10 SASI_Hs01_00030368 predicted 525
11 SASI_Hs01_00030362 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081976 predicted 441
2 SASI_Rn02_00259922 predicted 191
3 SASI_Rn01_00081978 predicted 492
4 SASI_Rn02_00259923 predicted 421
5 SASI_Rn01_00081979 predicted 1400
6 SASI_Rn01_00081980 predicted 603
7 SASI_Rn01_00081981 predicted 466
8 SASI_Rn01_00081982 predicted 1425
9 SASI_Rn01_00081983 predicted 657
10 SASI_Rn01_00081984 predicted 252
11 SASI_Rn01_00081975 predicted 599
12 SASI_Rn01_00081977 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188409 predicted 1487
2 SASI_Mm02_00315839 predicted 299
3 SASI_Mm01_00188410 predicted 354
4 SASI_Mm01_00188411 predicted 559
5 SASI_Mm01_00188412 predicted 341
6 SASI_Mm01_00188413 predicted 379
7 SASI_Mm01_00188414 predicted 652
8 SASI_Mm01_00188415 predicted 835
9 SASI_Mm01_00188416 predicted 575
10 SASI_Mm01_00188417 predicted 714
11 SASI_Mm01_00188418 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003179
SYP MISSION shRNA Bacterial Glycerol Stock
synaptophysin
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-651s1c1
Sequence:CCGGCAACCTGTGGTTCGTGTTTAACTCGAGTTAAACACGAACCACAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-229s1c1
Sequence:CCGGCTGCACCAAGTGTACTTTGATCTCGAGATCAAAGTACACTTGGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1376s21c1
Sequence:GTACCGGGCAATGCCTGCCTGAACAAAGCTCGAGCTTTGTTCAGGCAGGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-384s1c1
Sequence:CCGGGCAGAACAAGTACCGAGAGAACTCGAGTTCTCTCGGTACTTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-918s1c1
Sequence:CCGGCACCTCCTTCTCCAATCAGATCTCGAGATCTGATTGGAGAAGGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1406s21c1
Sequence:GTACCGGGAAATCCAACTCCAGGGTTAACTCGAGTTAACCCTGGAGTTGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-519s1c1
Sequence:CCGGAGAGAACATTATCAAGGAGATCTCGAGATCTCCTTGATAATGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-97s21c1
Sequence:GTACCGGCTTTGTGAAGGTGCTGCAATGCTCGAGCATTGCAGCACCTTCACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-666s21c1
Sequence:GTACCGGGCAACCTGTGGTTCGTGTTTACTCGAGTAAACACGAACCACAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-527s21c1
Sequence:GTACCGGACAGACCCAGAGAACATTATCCTCGAGGATAATGTTCTCTGGGTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-408s21c1
Sequence:GTACCGGAGTACCGAGAGAATAACAAAGCTCGAGCTTTGTTATTCTCTCGGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-285s21c1
Sequence:GTACCGGGCACCACCAAGGTCTTCTTAGCTCGAGCTAAGAAGACCTTGGTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003179
SYP MISSION shRNA shRNA Plasmid DNA
synaptophysin
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-651s1c1
Sequence:CCGGCAACCTGTGGTTCGTGTTTAACTCGAGTTAAACACGAACCACAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-229s1c1
Sequence:CCGGCTGCACCAAGTGTACTTTGATCTCGAGATCAAAGTACACTTGGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1376s21c1
Sequence:GTACCGGGCAATGCCTGCCTGAACAAAGCTCGAGCTTTGTTCAGGCAGGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-384s1c1
Sequence:CCGGGCAGAACAAGTACCGAGAGAACTCGAGTTCTCTCGGTACTTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-918s1c1
Sequence:CCGGCACCTCCTTCTCCAATCAGATCTCGAGATCTGATTGGAGAAGGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1406s21c1
Sequence:GTACCGGGAAATCCAACTCCAGGGTTAACTCGAGTTAACCCTGGAGTTGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-519s1c1
Sequence:CCGGAGAGAACATTATCAAGGAGATCTCGAGATCTCCTTGATAATGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-97s21c1
Sequence:GTACCGGCTTTGTGAAGGTGCTGCAATGCTCGAGCATTGCAGCACCTTCACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-666s21c1
Sequence:GTACCGGGCAACCTGTGGTTCGTGTTTACTCGAGTAAACACGAACCACAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-527s21c1
Sequence:GTACCGGACAGACCCAGAGAACATTATCCTCGAGGATAATGTTCTCTGGGTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-408s21c1
Sequence:GTACCGGAGTACCGAGAGAATAACAAAGCTCGAGCTTTGTTATTCTCTCGGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-285s21c1
Sequence:GTACCGGGCACCACCAAGGTCTTCTTAGCTCGAGCTAAGAAGACCTTGGTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003179
SYP MISSION shRNA Lentiviral Transduction Particles
synaptophysin
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-651s1c1
Sequence:CCGGCAACCTGTGGTTCGTGTTTAACTCGAGTTAAACACGAACCACAGGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-229s1c1
Sequence:CCGGCTGCACCAAGTGTACTTTGATCTCGAGATCAAAGTACACTTGGTGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1376s21c1
Sequence:GTACCGGGCAATGCCTGCCTGAACAAAGCTCGAGCTTTGTTCAGGCAGGCATTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-384s1c1
Sequence:CCGGGCAGAACAAGTACCGAGAGAACTCGAGTTCTCTCGGTACTTGTTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-918s1c1
Sequence:CCGGCACCTCCTTCTCCAATCAGATCTCGAGATCTGATTGGAGAAGGAGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003179.2-1406s21c1
Sequence:GTACCGGGAAATCCAACTCCAGGGTTAACTCGAGTTAACCCTGGAGTTGGATTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003179.1-519s1c1
Sequence:CCGGAGAGAACATTATCAAGGAGATCTCGAGATCTCCTTGATAATGTTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-97s21c1
Sequence:GTACCGGCTTTGTGAAGGTGCTGCAATGCTCGAGCATTGCAGCACCTTCACAAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-666s21c1
Sequence:GTACCGGGCAACCTGTGGTTCGTGTTTACTCGAGTAAACACGAACCACAGGTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-527s21c1
Sequence:GTACCGGACAGACCCAGAGAACATTATCCTCGAGGATAATGTTCTCTGGGTCTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-408s21c1
Sequence:GTACCGGAGTACCGAGAGAATAACAAAGCTCGAGCTTTGTTATTCTCTCGGTACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003179.2-285s21c1
Sequence:GTACCGGGCACCACCAAGGTCTTCTTAGCTCGAGCTAAGAAGACCTTGGTGGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009305
SYP MISSION shRNA Bacterial Glycerol Stock
synaptophysin
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-1039s21c1
Sequence:GTACCGGCCTTCTCCAATCAGATGTAATCTCGAGATTACATCTGATTGGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-175s1c1
Sequence:CCGGCTCAACATCGAAGTCGAATTTCTCGAGAAATTCGACTTCGATGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-797s1c1
Sequence:CCGGAGGGTGGTTATCAACCCGATTCTCGAGAATCGGGTTGATAACCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009305.1-1831s1c1
Sequence:CCGGCGGTTTCAGTTGAGTGGAGTTCTCGAGAACTCCACTCAACTGAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-173s1c1
Sequence:CCGGCCCTCAACATCGAAGTCGAATCTCGAGATTCGACTTCGATGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-537s1c1
Sequence:CCGGCCAGACAGGAAACACATGCAACTCGAGTTGCATGTGTTTCCTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-307s21c1
Sequence:GTACCGGTCAACATCGAAGTCGAATTTGCTCGAGCAAATTCGACTTCGATGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-412s21c1
Sequence:GTACCGGACTACTCCTCCTCGGCTGAATCTCGAGATTCAGCCGAGGAGGAGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-625s21c1
Sequence:GTACCGGCCACTGACCCAGAGAACATTACTCGAGTAATGTTCTCTGGGTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-930s21c1
Sequence:GTACCGGGGTGGTTATCAACCCGATTACCTCGAGGTAATCGGGTTGATAACCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-359s21c1
Sequence:GTACCGGTGATGCACCCTCCTGCGTTAACTCGAGTTAACGCAGGAGGGTGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009305
SYP MISSION shRNA shRNA Plasmid DNA
synaptophysin
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-1039s21c1
Sequence:GTACCGGCCTTCTCCAATCAGATGTAATCTCGAGATTACATCTGATTGGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-175s1c1
Sequence:CCGGCTCAACATCGAAGTCGAATTTCTCGAGAAATTCGACTTCGATGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-797s1c1
Sequence:CCGGAGGGTGGTTATCAACCCGATTCTCGAGAATCGGGTTGATAACCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009305.1-1831s1c1
Sequence:CCGGCGGTTTCAGTTGAGTGGAGTTCTCGAGAACTCCACTCAACTGAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-173s1c1
Sequence:CCGGCCCTCAACATCGAAGTCGAATCTCGAGATTCGACTTCGATGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-537s1c1
Sequence:CCGGCCAGACAGGAAACACATGCAACTCGAGTTGCATGTGTTTCCTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-307s21c1
Sequence:GTACCGGTCAACATCGAAGTCGAATTTGCTCGAGCAAATTCGACTTCGATGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-412s21c1
Sequence:GTACCGGACTACTCCTCCTCGGCTGAATCTCGAGATTCAGCCGAGGAGGAGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-625s21c1
Sequence:GTACCGGCCACTGACCCAGAGAACATTACTCGAGTAATGTTCTCTGGGTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-930s21c1
Sequence:GTACCGGGGTGGTTATCAACCCGATTACCTCGAGGTAATCGGGTTGATAACCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-359s21c1
Sequence:GTACCGGTGATGCACCCTCCTGCGTTAACTCGAGTTAACGCAGGAGGGTGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009305
SYP MISSION shRNA Lentiviral Transduction Particles
synaptophysin
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-1039s21c1
Sequence:GTACCGGCCTTCTCCAATCAGATGTAATCTCGAGATTACATCTGATTGGAGAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-175s1c1
Sequence:CCGGCTCAACATCGAAGTCGAATTTCTCGAGAAATTCGACTTCGATGTTGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-797s1c1
Sequence:CCGGAGGGTGGTTATCAACCCGATTCTCGAGAATCGGGTTGATAACCACCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009305.1-1831s1c1
Sequence:CCGGCGGTTTCAGTTGAGTGGAGTTCTCGAGAACTCCACTCAACTGAAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-173s1c1
Sequence:CCGGCCCTCAACATCGAAGTCGAATCTCGAGATTCGACTTCGATGTTGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009305.1-537s1c1
Sequence:CCGGCCAGACAGGAAACACATGCAACTCGAGTTGCATGTGTTTCCTGTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-307s21c1
Sequence:GTACCGGTCAACATCGAAGTCGAATTTGCTCGAGCAAATTCGACTTCGATGTTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-412s21c1
Sequence:GTACCGGACTACTCCTCCTCGGCTGAATCTCGAGATTCAGCCGAGGAGGAGTAGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-625s21c1
Sequence:GTACCGGCCACTGACCCAGAGAACATTACTCGAGTAATGTTCTCTGGGTCAGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-930s21c1
Sequence:GTACCGGGGTGGTTATCAACCCGATTACCTCGAGGTAATCGGGTTGATAACCACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009305.2-359s21c1
Sequence:GTACCGGTGATGCACCCTCCTGCGTTAACTCGAGTTAACGCAGGAGGGTGCATCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???